Transcript: Human NM_001278197.1

Homo sapiens CDK5 regulatory subunit associated protein 3 (CDK5RAP3), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-09-03
Taxon:
Homo sapiens (human)
Gene:
CDK5RAP3 (80279)
Length:
1995
CDS:
116..1711

Additional Resources:

NCBI RefSeq record:
NM_001278197.1
NBCI Gene record:
CDK5RAP3 (80279)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001278197.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000135914 GATTGGCAGGAGATTATAGCT pLKO.1 476 CDS 100% 3.000 2.400 N CDK5RAP3 n/a
2 TRCN0000330499 CGATCCGCGAGAAGATCAATG pLKO_005 297 CDS 100% 10.800 7.560 N CDK5RAP3 n/a
3 TRCN0000353742 GGTCCTACATTCACTACTTTC pLKO_005 369 CDS 100% 10.800 7.560 N CDK5RAP3 n/a
4 TRCN0000135657 GAGAAGGACAACACCTACTTA pLKO.1 503 CDS 100% 5.625 3.938 N CDK5RAP3 n/a
5 TRCN0000136838 CCCTCACTGAAGAAGCAGATT pLKO.1 569 CDS 100% 4.950 3.465 N CDK5RAP3 n/a
6 TRCN0000330498 CCCTCACTGAAGAAGCAGATT pLKO_005 569 CDS 100% 4.950 3.465 N CDK5RAP3 n/a
7 TRCN0000136052 GCAGGAGATTATAGCTCTGTA pLKO.1 481 CDS 100% 4.950 3.465 N CDK5RAP3 n/a
8 TRCN0000330497 GCAGGAGATTATAGCTCTGTA pLKO_005 481 CDS 100% 4.950 3.465 N CDK5RAP3 n/a
9 TRCN0000136898 CTTCACAGCGGATGAAGGATT pLKO.1 459 CDS 100% 0.495 0.347 N CDK5RAP3 n/a
10 TRCN0000137232 GAGGCCTCCACGAAGAATATT pLKO.1 425 CDS 100% 15.000 9.000 N CDK5RAP3 n/a
11 TRCN0000330496 GAGGCCTCCACGAAGAATATT pLKO_005 425 CDS 100% 15.000 9.000 N CDK5RAP3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001278197.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09023 pDONR223 100% 95.1% 94.9% None (many diffs) n/a
2 ccsbBroad304_09023 pLX_304 0% 95.1% 94.9% V5 (many diffs) n/a
3 TRCN0000480634 TTTTTAAGTTTGGGACTATATTCT pLX_317 23% 95.1% 94.9% V5 (many diffs) n/a
Download CSV