Transcript: Mouse NM_001278219.1

Mus musculus dispatched RND transporter family member 1 (Disp1), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-08-13
Taxon:
Mus musculus (mouse)
Gene:
Disp1 (68897)
Length:
4902
CDS:
312..4877

Additional Resources:

NCBI RefSeq record:
NM_001278219.1
NBCI Gene record:
Disp1 (68897)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001278219.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000258141 CCACGTGGAATATCATCATAA pLKO_005 3310 CDS 100% 13.200 18.480 N Disp1 n/a
2 TRCN0000265282 TGCGAAACACAGGGTACAAAG pLKO_005 1030 CDS 100% 10.800 8.640 N Disp1 n/a
3 TRCN0000200910 CGATGTGTGATGTGGATAATT pLKO.1 1270 CDS 100% 15.000 10.500 N Disp1 n/a
4 TRCN0000251100 CCTCTACCGAGTCGTCTTTAA pLKO_005 1940 CDS 100% 13.200 9.240 N Disp1 n/a
5 TRCN0000251101 TGGAATTTACCTGCAATTAAG pLKO_005 1248 CDS 100% 13.200 9.240 N Disp1 n/a
6 TRCN0000265317 ACAACGCCGTGTACCAGATTC pLKO_005 1570 CDS 100% 10.800 7.560 N Disp1 n/a
7 TRCN0000217016 CACACTTACAGTACGGATTAC pLKO.1 4135 CDS 100% 10.800 7.560 N Disp1 n/a
8 TRCN0000189540 CCAGATCCCTTTCCCTACAAA pLKO.1 3728 CDS 100% 5.625 3.375 N Disp1 n/a
9 TRCN0000255595 TGGAATTTACCTGCAATTAAA pLKO_005 1248 CDS 100% 15.000 10.500 N DISP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001278219.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12897 pDONR223 100% 30% 31.3% None (many diffs) n/a
2 ccsbBroad304_12897 pLX_304 0% 30% 31.3% V5 (many diffs) n/a
Download CSV