Transcript: Human NM_001278236.1

Homo sapiens protein tyrosine phosphatase non-receptor type 5 (PTPN5), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-08-05
Taxon:
Homo sapiens (human)
Gene:
PTPN5 (84867)
Length:
3939
CDS:
1266..2867

Additional Resources:

NCBI RefSeq record:
NM_001278236.1
NBCI Gene record:
PTPN5 (84867)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001278236.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000356152 ACGAGAAATGCACCGAGTATT pLKO_005 2383 CDS 100% 13.200 18.480 N PTPN5 n/a
2 TRCN0000367557 CATGCGAGCAGTACCAGTTTG pLKO_005 2791 CDS 100% 10.800 15.120 N PTPN5 n/a
3 TRCN0000002667 GAACGAGAAATGCACCGAGTA pLKO.1 2381 CDS 100% 4.050 3.240 N PTPN5 n/a
4 TRCN0000010728 CCACGGCAGACAGAGACATTT pLKO.1 3784 3UTR 100% 13.200 9.240 N PTPN5 n/a
5 TRCN0000356120 TTAACGATGGTTCCATCAATA pLKO_005 3143 3UTR 100% 13.200 9.240 N PTPN5 n/a
6 TRCN0000002666 AGTCATTCACACGGAGGATTA pLKO.1 2453 CDS 100% 10.800 7.560 N PTPN5 n/a
7 TRCN0000029907 CCTCTGAGTTCCTACATCAAT pLKO.1 2214 CDS 100% 5.625 3.938 N Ptpn5 n/a
8 TRCN0000002665 TCCTGTGTTTGATTGTGTGAT pLKO.1 1811 CDS 100% 4.950 3.465 N PTPN5 n/a
9 TRCN0000002664 GCTGCGACTCATCTCCCTCAA pLKO.1 2477 CDS 100% 1.350 0.945 N PTPN5 n/a
10 TRCN0000029904 GCAGGCGGAATTCTTTGAAAT pLKO.1 2069 CDS 100% 0.000 0.000 N Ptpn5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001278236.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09229 pDONR223 100% 94.2% 94.3% None 290_291ins96;1467G>A n/a
2 ccsbBroad304_09229 pLX_304 0% 94.2% 94.3% V5 290_291ins96;1467G>A n/a
3 TRCN0000472997 GCTATGGCGAGTGCACGTAGATGT pLX_317 20.6% 94.2% 94.3% V5 290_291ins96;1467G>A n/a
Download CSV