Transcript: Human NM_001278402.1

Homo sapiens RAB3A interacting protein (RAB3IP), transcript variant B, mRNA.

Source:
NCBI, updated 2019-08-03
Taxon:
Homo sapiens (human)
Gene:
RAB3IP (117177)
Length:
8781
CDS:
254..1018

Additional Resources:

NCBI RefSeq record:
NM_001278402.1
NBCI Gene record:
RAB3IP (117177)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001278402.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000416599 AGGGTTAGCAGAATGTATTAA pLKO_005 1337 3UTR 100% 15.000 21.000 N RAB3IP n/a
2 TRCN0000155592 CCAGAGTAAGTCCTGTAAACA pLKO.1 784 CDS 100% 5.625 3.938 N RAB3IP n/a
3 TRCN0000156982 CAAGGAGTGAGCCTAAGACTT pLKO.1 1101 3UTR 100% 4.950 3.465 N RAB3IP n/a
4 TRCN0000154773 GTAGCTGCATTGAAGACACTT pLKO.1 341 CDS 100% 4.950 3.465 N RAB3IP n/a
5 TRCN0000061283 GCACAATAACTCAGAATGAAA pLKO.1 4226 3UTR 100% 5.625 2.813 Y ITPR2 n/a
6 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 3122 3UTR 100% 13.200 6.600 Y LIAS n/a
7 TRCN0000166364 CACACACACACACACACACAA pLKO.1 3227 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001278402.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_16081 pDONR223 0% 100% 100% None n/a
2 ccsbBroad304_16081 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000468993 CATGCTATAGCATTGACGGAGATG pLX_317 69.1% 100% 100% V5 n/a
Download CSV