Transcript: Human NM_001278464.1

Homo sapiens dynamin 1 like (DNM1L), transcript variant 5, mRNA.

Source:
NCBI, updated 2019-09-03
Taxon:
Homo sapiens (human)
Gene:
DNM1L (10059)
Length:
4654
CDS:
165..2414

Additional Resources:

NCBI RefSeq record:
NM_001278464.1
NBCI Gene record:
DNM1L (10059)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001278464.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000001097 GCTACTTTACTCCAACTTATT pLKO.1 1194 CDS 100% 13.200 18.480 N DNM1L n/a
2 TRCN0000318424 GCTACTTTACTCCAACTTATT pLKO_005 1194 CDS 100% 13.200 18.480 N DNM1L n/a
3 TRCN0000010594 CGGTGGTGCTAGAATTTGTTA pLKO.1 1286 CDS 100% 5.625 7.875 N DNM1L n/a
4 TRCN0000318425 CGGTGGTGCTAGAATTTGTTA pLKO_005 1286 CDS 100% 5.625 7.875 N DNM1L n/a
5 TRCN0000001098 CGGTTCATCAGTAATCCTAAT pLKO.1 717 CDS 100% 10.800 8.640 N DNM1L n/a
6 TRCN0000318423 CGGTTCATCAGTAATCCTAAT pLKO_005 717 CDS 100% 10.800 8.640 N DNM1L n/a
7 TRCN0000001099 CGAGATTGTGAGGTTATTGAA pLKO.1 2127 CDS 100% 5.625 4.500 N DNM1L n/a
8 TRCN0000318426 CGAGATTGTGAGGTTATTGAA pLKO_005 2127 CDS 100% 5.625 4.500 N DNM1L n/a
9 TRCN0000010593 GCACCAAGACAACATTTCATA pLKO.1 2796 3UTR 100% 5.625 3.938 N DNM1L n/a
10 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 3455 3UTR 100% 4.950 2.475 Y ERAP2 n/a
11 TRCN0000012607 CCTGCTTTATTTGTGCCTGAA pLKO.1 1413 CDS 100% 4.050 2.835 N Dnm1l n/a
12 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 3456 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001278464.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02298 pDONR223 100% 94.7% 94.7% None 250_288del;1632_1709del n/a
2 ccsbBroad304_02298 pLX_304 0% 94.7% 94.7% V5 250_288del;1632_1709del n/a
3 TRCN0000477846 GTGGCCGACCACGGGTCATCTCTT pLX_317 23% 94.7% 94.7% V5 (not translated due to prior stop codon) 250_288del;1632_1709del n/a
Download CSV