Transcript: Human NM_001278690.1

Homo sapiens FGFR1 oncogene partner (FGFR1OP), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-04-02
Taxon:
Homo sapiens (human)
Gene:
FGFR1OP (11116)
Length:
3451
CDS:
97..1152

Additional Resources:

NCBI RefSeq record:
NM_001278690.1
NBCI Gene record:
FGFR1OP (11116)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001278690.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000294369 ATACCAAAGACGGTCGTTTAG pLKO_005 296 CDS 100% 10.800 15.120 N FGFR1OP n/a
2 TRCN0000084089 CGAGAGAATTTAGCCCGAGAT pLKO.1 415 CDS 100% 4.050 5.670 N FGFR1OP n/a
3 TRCN0000286955 CGAGAGAATTTAGCCCGAGAT pLKO_005 415 CDS 100% 4.050 5.670 N FGFR1OP n/a
4 TRCN0000251868 CTGTGGGTGGACCCTTATTAT pLKO_005 461 CDS 100% 15.000 10.500 N Fgfr1op n/a
5 TRCN0000294394 CTGTGGGTGGACCCTTATTAT pLKO_005 461 CDS 100% 15.000 10.500 N FGFR1OP n/a
6 TRCN0000084088 GCATGATGAAAGGTGTCAATA pLKO.1 1311 3UTR 100% 13.200 9.240 N FGFR1OP n/a
7 TRCN0000286956 GCATGATGAAAGGTGTCAATA pLKO_005 1311 3UTR 100% 13.200 9.240 N FGFR1OP n/a
8 TRCN0000084090 CCCATTCCTAAGCCAGAGAAA pLKO.1 730 CDS 100% 4.950 3.465 N FGFR1OP n/a
9 TRCN0000286896 CCCATTCCTAAGCCAGAGAAA pLKO_005 730 CDS 100% 4.950 3.465 N FGFR1OP n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001278690.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07754 pDONR223 100% 88.5% 84.8% None (many diffs) n/a
2 ccsbBroad304_07754 pLX_304 0% 88.5% 84.8% V5 (many diffs) n/a
3 TRCN0000468162 CGAAATTGTCCAGAAATAATCTCC pLX_317 34.7% 88.5% 84.8% V5 (many diffs) n/a
Download CSV