Transcript: Human NM_001281532.3

Homo sapiens presenilin enhancer, gamma-secretase subunit (PSENEN), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-03
Taxon:
Homo sapiens (human)
Gene:
PSENEN (55851)
Length:
1086
CDS:
109..414

Additional Resources:

NCBI RefSeq record:
NM_001281532.3
NBCI Gene record:
PSENEN (55851)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001281532.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000364530 TACACAGAACAGAGCCAAATC pLKO_005 247 CDS 100% 10.800 7.560 N PSENEN n/a
2 TRCN0000364529 ACTACCTCTCCTTCACCATAC pLKO_005 377 CDS 100% 6.000 4.200 N PSENEN n/a
3 TRCN0000157820 CTTCCTCTTCTGGGTGATAGT pLKO.1 297 CDS 100% 4.950 3.465 N PSENEN n/a
4 TRCN0000154812 GAGCCAAATCAAAGGCTATGT pLKO.1 258 CDS 100% 4.950 3.465 N PSENEN n/a
5 TRCN0000155359 GATCACCATCTTCCAGATCTA pLKO.1 330 CDS 100% 4.950 3.465 N PSENEN n/a
6 TRCN0000155181 GTCAACATCTTCTGGTTCTTC pLKO.1 202 CDS 100% 4.950 3.465 N PSENEN n/a
7 TRCN0000364527 TGAACCTGTGCCGGAAGTACT pLKO_005 143 CDS 100% 4.950 3.465 N PSENEN n/a
8 TRCN0000369157 TTCTCTGGTTGGTCAACATCT pLKO_005 191 CDS 100% 4.950 3.465 N PSENEN n/a
9 TRCN0000155511 CAGAGCCAAATCAAAGGCTAT pLKO.1 256 CDS 100% 4.050 2.835 N PSENEN n/a
10 TRCN0000369231 TCAACATCTTCTGGTTCTTCC pLKO_005 203 CDS 100% 4.050 2.835 N PSENEN n/a
11 TRCN0000376492 TCACCTCCTGGATCACCATCT pLKO_005 320 CDS 100% 4.050 2.835 N PSENEN n/a
12 TRCN0000369229 TTCCTTGTCCCAGCCTACACA pLKO_005 232 CDS 100% 3.000 2.100 N PSENEN n/a
13 TRCN0000369230 TTCTTCCGAGAGGCCTTCCTT pLKO_005 217 CDS 100% 3.000 2.100 N PSENEN n/a
14 TRCN0000157136 GAAATTGAACCTGTGCCGGAA pLKO.1 138 CDS 100% 2.160 1.512 N PSENEN n/a
15 TRCN0000156330 CTGGATCACCATCTTCCAGAT pLKO.1 327 CDS 100% 0.405 0.243 N PSENEN n/a
16 TRCN0000304889 ACTACCTCTCCTTCACCATTC pLKO_005 377 CDS 100% 6.000 4.200 N Psenen n/a
17 TRCN0000097950 GCCAAATCAAAGGCTATGTTT pLKO.1 260 CDS 100% 5.625 3.938 N Psenen n/a
18 TRCN0000172742 GAGACAGAGTCTTGCTCTGTT pLKO.1 812 3UTR 100% 0.495 0.248 Y C11orf44 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001281532.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03668 pDONR223 100% 100% 100% None n/a
2 TRCN0000478795 AAGAGCCGGCCCCCTCATGCAATG pLX_317 100% 100% 100% V5 n/a
Download CSV