Transcript: Human NM_001281716.1

Homo sapiens ubiquitin B (UBB), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-03
Taxon:
Homo sapiens (human)
Gene:
UBB (7314)
Length:
1097
CDS:
251..940

Additional Resources:

NCBI RefSeq record:
NM_001281716.1
NBCI Gene record:
UBB (7314)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001281716.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000086859 GAAGGCCAAGATCCAGGATAA pLKO.1 328 CDS 100% 10.800 6.480 N Gm1821 n/a
2 TRCN0000007737 GCCAAGATCCAGGATAAAGAA pLKO.1 560 CDS 100% 5.625 3.375 N UBB n/a
3 TRCN0000007735 CCGTACTCTTTCTGACTACAA pLKO.1 409 CDS 100% 4.950 2.970 N UBB n/a
4 TRCN0000432189 TGGAAGATGGCCGTACTCTTT pLKO_005 399 CDS 100% 4.950 2.970 N UBB n/a
5 TRCN0000007736 CCGCACTCTTTCTGACTACAA pLKO.1 637 CDS 100% 4.950 2.475 Y UBB n/a
6 TRCN0000413456 GAAGATGGCCGCACTCTTTCT pLKO_005 629 CDS 100% 4.950 2.475 Y UBB n/a
7 TRCN0000011103 GTGAAGGCCAAGATCCAAGAT pLKO.1 782 CDS 100% 4.950 2.475 Y UBB n/a
8 TRCN0000007187 GCCAAGATCCAGGATAAGGAA pLKO.1 332 CDS 100% 3.000 1.500 Y RPS27A n/a
9 TRCN0000273406 GCCAAGATCCAGGATAAGGAA pLKO_005 332 CDS 100% 3.000 1.500 Y RPS27A n/a
10 TRCN0000011102 CCTGCGTCTGAGAGGTGGTAT pLKO.1 460 CDS 100% 1.650 0.825 Y UBB n/a
11 TRCN0000414438 TGAAGACCCTGACCGGCAAGA pLKO_005 492 CDS 100% 1.350 0.675 Y UBB n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001281716.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14872 pDONR223 58.4% 98.6% 100% None (many diffs) n/a
2 ccsbBroad304_14872 pLX_304 0% 98.6% 100% V5 (many diffs) n/a
3 TRCN0000468005 TCGGGCCTGTCTTATCTTATATCC pLX_317 100% 32.8% 33.6% V5 (many diffs) n/a
4 ccsbBroadEn_14873 pDONR223 70.1% 98.6% 100% None (many diffs) n/a
5 ccsbBroad304_14873 pLX_304 0% 98.6% 100% V5 (many diffs) n/a
Download CSV