Transcript: Mouse NM_001281929.1

Mus musculus glutamate receptor, ionotropic, AMPA3 (alpha 3) (Gria3), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Gria3 (53623)
Length:
5224
CDS:
265..2931

Additional Resources:

NCBI RefSeq record:
NM_001281929.1
NBCI Gene record:
Gria3 (53623)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001281929.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000102931 CGTAGGACAAATTATACCATT pLKO.1 1375 CDS 100% 4.950 6.930 N Gria3 n/a
2 TRCN0000102932 CGCTACATACAGAGAAGGCTA pLKO.1 2877 CDS 100% 2.640 3.696 N Gria3 n/a
3 TRCN0000102934 CCGTGTGATACGATGAAAGTT pLKO.1 2491 CDS 100% 5.625 3.938 N Gria3 n/a
4 TRCN0000102933 CCTGGAGTCAAGGAATTGATA pLKO.1 1286 CDS 100% 5.625 3.938 N Gria3 n/a
5 TRCN0000061724 GCAGAGTCCAAACGCATGAAA pLKO.1 2800 CDS 100% 5.625 3.938 N GRIA3 n/a
6 TRCN0000102930 GAGCCAGATTTCACTCTCCTT pLKO.1 3011 3UTR 100% 2.640 1.848 N Gria3 n/a
7 TRCN0000166364 CACACACACACACACACACAA pLKO.1 3327 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001281929.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10860 pDONR223 100% 84.8% 88.9% None (many diffs) n/a
2 ccsbBroad304_10860 pLX_304 0% 84.8% 88.9% V5 (many diffs) n/a
3 TRCN0000473212 ACCATGTACTTTATCTCACGGACA pLX_317 17.3% 84.8% 88.9% V5 (many diffs) n/a
Download CSV