Transcript: Mouse NM_001282041.1

Mus musculus phosphomannomutase 1 (Pmm1), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-06-11
Taxon:
Mus musculus (mouse)
Gene:
Pmm1 (29858)
Length:
1020
CDS:
11..622

Additional Resources:

NCBI RefSeq record:
NM_001282041.1
NBCI Gene record:
Pmm1 (29858)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001282041.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000248273 TCTCCCGAGGAGGCATGATAA pLKO_005 375 CDS 100% 13.200 18.480 N Pmm1 n/a
2 TRCN0000184541 GTTCTCGGAACTGGACAAGAA pLKO.1 289 CDS 100% 4.950 6.930 N Pmm1 n/a
3 TRCN0000248272 GGCCTGAAGATAGAACCATTG pLKO_005 668 3UTR 100% 6.000 4.200 N Pmm1 n/a
4 TRCN0000183017 CATCATCCACTTCTTTGGAAA pLKO.1 466 CDS 100% 4.950 2.970 N Pmm1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001282041.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01227 pDONR223 100% 48.7% 50.5% None (many diffs) n/a
2 ccsbBroad304_01227 pLX_304 0% 48.7% 50.5% V5 (many diffs) n/a
3 TRCN0000469573 TCTGTGGTAGCATGCATCGGGCCT pLX_317 57% 48.7% 50.5% V5 (many diffs) n/a
Download CSV