Transcript: Human NM_001282131.2

Homo sapiens slingshot protein phosphatase 2 (SSH2), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
SSH2 (85464)
Length:
1030
CDS:
156..764

Additional Resources:

NCBI RefSeq record:
NM_001282131.2
NBCI Gene record:
SSH2 (85464)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001282131.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000257403 CAGAATCGAACACGCTATATG pLKO_005 477 CDS 100% 13.200 18.480 N SSH2 n/a
2 TRCN0000006943 CCAGAATCGAACACGCTATAT pLKO.1 476 CDS 100% 13.200 18.480 N SSH2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001282131.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12916 pDONR223 100% 88.1% 88.1% None 1_72del n/a
2 ccsbBroad304_12916 pLX_304 0% 88.1% 88.1% V5 1_72del n/a
3 TRCN0000467800 CCATCTTGTACCCAATCACTGTTA pLX_317 63.5% 88.1% 88.1% V5 1_72del n/a
4 TRCN0000488828 AACTGCCTATCTGGCAAAGACCTC pLX_317 20.6% 33.9% 29.7% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV