Transcript: Human NM_001282162.2

Homo sapiens capping actin protein of muscle Z-line subunit beta (CAPZB), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-06-01
Taxon:
Homo sapiens (human)
Gene:
CAPZB (832)
Length:
1677
CDS:
17..922

Additional Resources:

NCBI RefSeq record:
NM_001282162.2
NBCI Gene record:
CAPZB (832)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001282162.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000029347 GACCAGTATCGAGACCTGTAT pLKO.1 416 CDS 100% 4.950 6.930 N CAPZB n/a
2 TRCN0000318894 GACCAGTATCGAGACCTGTAT pLKO_005 416 CDS 100% 4.950 6.930 N CAPZB n/a
3 TRCN0000029344 AGATGGATCAAAGAAGATCAA pLKO.1 517 CDS 100% 4.950 3.465 N CAPZB n/a
4 TRCN0000318967 AGATGGATCAAAGAAGATCAA pLKO_005 517 CDS 100% 4.950 3.465 N CAPZB n/a
5 TRCN0000029348 GAACGAGATCTACTTTGGAAA pLKO.1 787 CDS 100% 4.950 3.465 N CAPZB n/a
6 TRCN0000318899 GAACGAGATCTACTTTGGAAA pLKO_005 787 CDS 100% 4.950 3.465 N CAPZB n/a
7 TRCN0000029345 CCTATAGGTCACCATGGAGTA pLKO.1 312 CDS 100% 4.050 2.835 N CAPZB n/a
8 TRCN0000029346 GCCTGGTAGAGGACATGGAAA pLKO.1 747 CDS 100% 4.950 2.970 N CAPZB n/a
9 TRCN0000318964 GCCTGGTAGAGGACATGGAAA pLKO_005 747 CDS 100% 4.950 2.970 N CAPZB n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001282162.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00218 pDONR223 100% 90.3% 90% None 1_85del;88_89delCA n/a
2 ccsbBroad304_00218 pLX_304 0% 90.3% 90% V5 1_85del;88_89delCA n/a
3 TRCN0000472378 GTTACTGCGCTTCTCCCTAGTCGT pLX_317 55.5% 90.3% 90% V5 1_85del;88_89delCA n/a
Download CSV