Construct: ORF TRCN0000472378
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF007838.1_s317c1
- Derived from:
- ccsbBroadEn_00218
- DNA Barcode:
- GTTACTGCGCTTCTCCCTAGTCGT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- CAPZB (832)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000472378
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 832 | CAPZB | capping actin protein of mu... | NM_004930.5 | 100% | 100% | |
| 2 | human | 832 | CAPZB | capping actin protein of mu... | NM_001206540.3 | 92.5% | 90.6% | (many diffs) |
| 3 | human | 832 | CAPZB | capping actin protein of mu... | NM_001282162.2 | 90.3% | 90% | 1_85del;88_89delCA |
| 4 | human | 832 | CAPZB | capping actin protein of mu... | XM_017002428.2 | 88.2% | 86.2% | (many diffs) |
| 5 | human | 832 | CAPZB | capping actin protein of mu... | XM_006710938.4 | 84.4% | 82.2% | (many diffs) |
| 6 | human | 832 | CAPZB | capping actin protein of mu... | XM_011542228.3 | 83.8% | 81.6% | (many diffs) |
| 7 | human | 832 | CAPZB | capping actin protein of mu... | NM_001206541.3 | 78.4% | 73% | (many diffs) |
| 8 | human | 832 | CAPZB | capping actin protein of mu... | XM_024450096.1 | 68% | 68% | 0_1ins261 |
| 9 | human | 832 | CAPZB | capping actin protein of mu... | XM_024450097.1 | 68% | 68% | 0_1ins261 |
| 10 | human | 832 | CAPZB | capping actin protein of mu... | XM_011542229.3 | 61.6% | 59.2% | (many diffs) |
| 11 | human | 832 | CAPZB | capping actin protein of mu... | XM_011542230.3 | 61.6% | 59.2% | (many diffs) |
| 12 | human | 832 | CAPZB | capping actin protein of mu... | NM_001313932.2 | 41% | 40.8% | 331_332insATTTTGAAGGTG;334T>G;336_337ins468 |
| 13 | human | 832 | CAPZB | capping actin protein of mu... | XM_017002429.2 | 37% | 36.5% | (many diffs) |
| 14 | human | 832 | CAPZB | capping actin protein of mu... | XM_017002430.2 | 36.5% | 36.2% | 1_85del;88_89delCA;417_418ins486 |
| 15 | mouse | 12345 | Capzb | capping protein (actin fila... | NM_009798.4 | 92.7% | 100% | (many diffs) |
| 16 | mouse | 12345 | Capzb | capping protein (actin fila... | NM_001037761.2 | 86.6% | 90.6% | (many diffs) |
| 17 | mouse | 12345 | Capzb | capping protein (actin fila... | NM_001271405.1 | 83.6% | 90% | (many diffs) |
| 18 | mouse | 12345 | Capzb | capping protein (actin fila... | XM_006538504.3 | 78.3% | 81.6% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 885
- ORF length:
- 816
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat gagtgatcag cagctggact gtgccttgga cctaatgagg cgcctgcctc 121 cccagcaaat cgagaaaaac ctcagcgacc tgatcgacct ggtccccagt ctatgtgagg 181 atctcctgtc ttctgttgac cagccactga aaattgccag agacaaggtg gtgggaaagg 241 attacctttt gtgtgactac aacagagatg gggactccta taggtcacca tggagtaaca 301 agtatgaccc tcccttggag gatggggcca tgccgtcagc tcggctgaga aagctggagg 361 tggaagccaa caatgccttt gaccagtatc gagacctgta ttttgaaggt ggcgtctcat 421 ctgtctaccT CTGGGATCTG GATCATGGCT TTGCTGGAGT GATCCTCATA AAGAAGGCTG 481 GAGATGGATC AAAGAAGATC AAAGGCTGCT GGGATTCCAT CCACGTGGTA GAAGTGCAGG 541 AGAAATCCAG CGGTCGCACC GCCCATTACA AGTTGACCTC CACGGTGATG CTGTGGCTGC 601 AGACCAACAA ATCTGGCTCT GGCACCATGA ACCTCGGAGG CAGCCTTACC AGACAGATGG 661 AGAAGGATGA AACTGTGAGT GACTGCTCCC CACACATAGC CAACATCGGG CGCCTGGTAG 721 AGGACATGGA AAATAAAATC AGAAGTACGC TGAACGAGAT CTACTTTGGA AAAACAAAGG 781 ATATCGTCAA TGGGCTGAGG TCTGTGCAGA CTTTTGCAGA CAAATCAAAA CAAGAAGCTC 841 TGAAGAATGA CCTGGTGGAG GCTTTGAAGA GAAAGCAGCA ATGCTTGCCA ACTTTCTTGT 901 ACAAAGTGGT TGATATCGGT AAGCCTATCC CTAACCCTCT CCTCGGTCTC GATTCTACGT 961 AGTAATGAAC TAGTCCGTAA CTTGAAAGTA TTTCGATTTC TTGGCTTTAT ATATCTTGTG 1021 GAAAGGACGA GTTACTGCGC TTCTCCCTAG TCGTACGCGT TAAGTCgaca atcaacctct 1081 ggattacaaa atttgtgaaa gatt