Transcript: Human NM_001282175.1

Homo sapiens CLPTM1 regulator of GABA type A receptor forward trafficking (CLPTM1), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-09-22
Taxon:
Homo sapiens (human)
Gene:
CLPTM1 (1209)
Length:
2498
CDS:
64..2031

Additional Resources:

NCBI RefSeq record:
NM_001282175.1
NBCI Gene record:
CLPTM1 (1209)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001282175.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000331170 GCACTTTGCTGAGCTCGATAT pLKO_005 462 CDS 100% 10.800 15.120 N CLPTM1 n/a
2 TRCN0000082946 CGACCAAAGTGTATGATGATA pLKO.1 1421 CDS 100% 5.625 7.875 N CLPTM1 n/a
3 TRCN0000082945 GCTGTTTAGGATCTTCATCAT pLKO.1 198 CDS 100% 4.950 6.930 N CLPTM1 n/a
4 TRCN0000331169 CAAGGACAAGTCCACGTATAT pLKO_005 1392 CDS 100% 13.200 9.240 N CLPTM1 n/a
5 TRCN0000082947 CTCCATCTACATCCACGTTTA pLKO.1 507 CDS 100% 10.800 7.560 N CLPTM1 n/a
6 TRCN0000291383 CTCCATCTACATCCACGTTTA pLKO_005 507 CDS 100% 10.800 7.560 N CLPTM1 n/a
7 TRCN0000082944 CCTGGATCAATATGTGAAGTT pLKO.1 804 CDS 100% 4.950 3.465 N CLPTM1 n/a
8 TRCN0000291382 CCTGGATCAATATGTGAAGTT pLKO_005 804 CDS 100% 4.950 3.465 N CLPTM1 n/a
9 TRCN0000082943 ACCACTGGGAATCATGGTGAA pLKO.1 2274 3UTR 100% 4.050 2.835 N CLPTM1 n/a
10 TRCN0000331168 TTGTTTGTGGAGGCGCTGTCT pLKO_005 2204 3UTR 100% 2.640 1.848 N CLPTM1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001282175.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15386 pDONR223 0% 96.9% 96.4% None (many diffs) n/a
2 ccsbBroad304_15386 pLX_304 0% 96.9% 96.4% V5 (many diffs) n/a
3 ccsbBroadEn_06013 pDONR223 100% 93.8% 92.5% None (many diffs) n/a
4 ccsbBroad304_06013 pLX_304 0% 93.8% 92.5% V5 (many diffs) n/a
5 TRCN0000475068 CCAGGTAATGCTACACACGGGTTT pLX_317 15.5% 93.8% 92.5% V5 (many diffs) n/a
Download CSV