Transcript: Human NM_001282427.2

Homo sapiens phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit gamma (PIK3CG), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PIK3CG (5294)
Length:
6983
CDS:
82..3390

Additional Resources:

NCBI RefSeq record:
NM_001282427.2
NBCI Gene record:
PIK3CG (5294)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001149186 GAGAATACGTCCTCCACATG pXPR_003 TGG 1449 44% 2 0.5241 PIK3CG PIK3CG 76334
2 BRDN0001147429 ACTTAACCCTCTCACAGCAG pXPR_003 AGG 1705 52% 2 0.2201 PIK3CG PIK3CG 76333
3 BRDN0001149132 TTGCCTCTACAAAAACTGTG pXPR_003 AGG 1139 34% 2 0.0752 PIK3CG PIK3CG 76335
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001282427.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000414541 GGAGAATATTCTCGGTTTAAA pLKO_005 3633 3UTR 100% 15.000 21.000 N PIK3CG n/a
2 TRCN0000430313 TACGAATCATGGAGTCTATTT pLKO_005 2624 CDS 100% 13.200 18.480 N PIK3CG n/a
3 TRCN0000033282 CGGGCACATTCTTGGGAATTA pLKO.1 2976 CDS 100% 13.200 10.560 N PIK3CG n/a
4 TRCN0000232402 GACGTCAGTTCCCAAGTTATT pLKO_005 2353 CDS 100% 13.200 10.560 N Pik3cg n/a
5 TRCN0000419619 AGCATATCCTAAGCTATTTAG pLKO_005 1842 CDS 100% 13.200 9.240 N PIK3CG n/a
6 TRCN0000421699 AGTTAGTGTTCTATGGTTTAA pLKO_005 3415 3UTR 100% 13.200 9.240 N PIK3CG n/a
7 TRCN0000361703 CAAGATCAGAGGCATTGATAT pLKO_005 1170 CDS 100% 13.200 9.240 N Pik3cg n/a
8 TRCN0000422411 CATCTGGGTTTAGTCTCAATT pLKO_005 3749 3UTR 100% 13.200 9.240 N PIK3CG n/a
9 TRCN0000033281 GCCCTATCAAATGAAACAATT pLKO.1 2545 CDS 100% 13.200 9.240 N PIK3CG n/a
10 TRCN0000196870 GCCTTATCCATTTCCCATTTA pLKO.1 4515 3UTR 100% 13.200 9.240 N PIK3CG n/a
11 TRCN0000421875 GTGAAAGACGCCACGACAATT pLKO_005 2725 CDS 100% 13.200 9.240 N PIK3CG n/a
12 TRCN0000199330 CTCCAGATCTACTGCGGTAAA pLKO.1 1372 CDS 100% 10.800 7.560 N PIK3CG n/a
13 TRCN0000196339 GACATCTGTGTTAAGGCTTAT pLKO.1 3112 CDS 100% 10.800 7.560 N PIK3CG n/a
14 TRCN0000196449 GACTGAATCTTTGGATCTATG pLKO.1 2649 CDS 100% 10.800 7.560 N PIK3CG n/a
15 TRCN0000033279 GCAACCTTTGTTCTTGGAATA pLKO.1 2893 CDS 100% 10.800 7.560 N PIK3CG n/a
16 TRCN0000033280 GCAGAGCTTCTTCACCAAGAT pLKO.1 816 CDS 100% 4.950 3.465 N PIK3CG n/a
17 TRCN0000196637 GCAGTTTAATTGGTTTCTACA pLKO.1 3327 CDS 100% 4.950 3.465 N PIK3CG n/a
18 TRCN0000195574 CAATGTCCAGTGCTAGGATTA pLKO.1 3574 3UTR 100% 10.800 6.480 N PIK3CG n/a
19 TRCN0000033283 CCTGTGGAAGAAGATTGCCAA pLKO.1 711 CDS 100% 2.640 1.584 N PIK3CG n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001282427.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14762 pDONR223 0% 99.9% 100% None 972A>G;981T>C;2025C>T n/a
2 ccsbBroad304_14762 pLX_304 0% 99.9% 100% V5 972A>G;981T>C;2025C>T n/a
3 TRCN0000480523 TACTATCAGTCTAGTTATCATTTA pLX_317 12.4% 99.8% 99.9% V5 (many diffs) n/a
4 ccsbBroadEn_06727 pDONR223 100% 99.8% 99.9% None (many diffs) n/a
5 ccsbBroad304_06727 pLX_304 0% 99.8% 99.9% V5 (many diffs) n/a
6 TRCN0000481299 CCCACTCTGTAACCGTTGCGGCCC pLX_317 13.1% 99.8% 99.9% V5 (many diffs) n/a
Download CSV