Transcript: Human NM_001282498.1

Homo sapiens zinc finger protein 343 (ZNF343), transcript variant 5, mRNA.

Source:
NCBI, updated 2018-06-30
Taxon:
Homo sapiens (human)
Gene:
ZNF343 (79175)
Length:
3318
CDS:
433..1962

Additional Resources:

NCBI RefSeq record:
NM_001282498.1
NBCI Gene record:
ZNF343 (79175)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001282498.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000016817 GCAGCTAGACAAAGGCTTGAA pLKO.1 834 CDS 100% 4.950 6.930 N ZNF343 n/a
2 TRCN0000318858 GCAGCTAGACAAAGGCTTGAA pLKO_005 834 CDS 100% 4.950 6.930 N ZNF343 n/a
3 TRCN0000016815 GCCGAGGCTTTAGTCGGAAAT pLKO.1 1574 CDS 100% 10.800 7.560 N ZNF343 n/a
4 TRCN0000318859 GCCGAGGCTTTAGTCGGAAAT pLKO_005 1574 CDS 100% 10.800 7.560 N ZNF343 n/a
5 TRCN0000016814 CGGACCATAACCTGGAATCAA pLKO.1 905 CDS 100% 5.625 3.938 N ZNF343 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001282498.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15146 pDONR223 69% 84.7% 84.4% None (many diffs) n/a
2 ccsbBroad304_15146 pLX_304 0% 84.7% 84.4% V5 (many diffs) n/a
3 TRCN0000469065 CGCCTTGTCACGCTGGTATCGCTA pLX_317 27% 52.1% 52% V5 0_1ins270;935T>C;940_1527del n/a
Download CSV