Transcript: Human NM_001282668.1

Homo sapiens microtubule associated monooxygenase, calponin and LIM domain containing 2 (MICAL2), transcript variant 7, mRNA.

Source:
NCBI, updated 2019-09-10
Taxon:
Homo sapiens (human)
Gene:
MICAL2 (9645)
Length:
1134
CDS:
300..899

Additional Resources:

NCBI RefSeq record:
NM_001282668.1
NBCI Gene record:
MICAL2 (9645)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001282668.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000233087 CCAAAGCCCTGTGGTACAAAT pLKO_005 484 CDS 100% 13.200 9.240 N MICAL2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001282668.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07456 pDONR223 100% 17.5% 17.3% None (many diffs) n/a
2 ccsbBroad304_07456 pLX_304 0% 17.5% 17.3% V5 (many diffs) n/a
3 TRCN0000471327 GGAACCAGACAGATTGGCCTCCAG pLX_317 11.7% 17.5% 17.3% V5 (many diffs) n/a
Download CSV