Transcript: Human NM_001282780.2

Homo sapiens ankyrin repeat and MYND domain containing 1 (ANKMY1), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-06-02
Taxon:
Homo sapiens (human)
Gene:
ANKMY1 (51281)
Length:
2475
CDS:
126..2288

Additional Resources:

NCBI RefSeq record:
NM_001282780.2
NBCI Gene record:
ANKMY1 (51281)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001282780.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000421844 CAATCCTTTCATCATCATTTA pLKO_005 796 CDS 100% 13.200 9.240 N ANKMY1 n/a
2 TRCN0000151305 GAAGCTTGGATATGGCAAATT pLKO.1 422 CDS 100% 13.200 9.240 N ANKMY1 n/a
3 TRCN0000416808 CTCACTGCCACAACGACATTG pLKO_005 607 CDS 100% 10.800 7.560 N ANKMY1 n/a
4 TRCN0000158402 CGTGAACAAGTGCTCAGATGA pLKO.1 656 CDS 100% 4.950 3.465 N ANKMY1 n/a
5 TRCN0000151189 GTTGAACATGAAGCTTGGATA pLKO.1 413 CDS 100% 4.950 3.465 N ANKMY1 n/a
6 TRCN0000157490 GTGGACTATGGCTACTTCAGA pLKO.1 1806 CDS 100% 3.000 2.100 N ANKMY1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001282780.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14145 pDONR223 100% 60.8% 60.5% None (many diffs) n/a
2 ccsbBroad304_14145 pLX_304 0% 60.8% 60.5% V5 (many diffs) n/a
3 TRCN0000472878 GATCTGCCTGAATCTACATGATTT pLX_317 37.5% 60.8% 40.8% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV