Transcript: Human NM_001282957.2

Homo sapiens cilia and flagella associated protein 77 (CFAP77), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-06-02
Taxon:
Homo sapiens (human)
Gene:
CFAP77 (389799)
Length:
1725
CDS:
62..916

Additional Resources:

NCBI RefSeq record:
NM_001282957.2
NBCI Gene record:
CFAP77 (389799)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001282957.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000129682 CCGGAATTATATCGCAATGAA pLKO.1 412 CDS 100% 5.625 7.875 N CFAP77 n/a
2 TRCN0000130536 GACCCGGAATTATATCGCAAT pLKO.1 409 CDS 100% 4.050 5.670 N CFAP77 n/a
3 TRCN0000130249 CCCGGAATTATATCGCAATGA pLKO.1 411 CDS 100% 4.950 3.465 N CFAP77 n/a
4 TRCN0000130411 GCCATCTTGACATAGTGGAAA pLKO.1 941 3UTR 100% 4.950 3.465 N CFAP77 n/a
5 TRCN0000129050 GAAAGCCATCAAACTGGAGAA pLKO.1 661 CDS 100% 4.050 2.835 N CFAP77 n/a
6 TRCN0000130127 CAAACTGGAGAAGAAGCAGAA pLKO.1 670 CDS 100% 4.050 2.430 N CFAP77 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001282957.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13662 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_13662 pLX_304 0% 100% 100% V5 n/a
3 ccsbBroadEn_14495 pDONR223 100% 99.7% 99.6% None 4C>G;435T>C n/a
4 ccsbBroad304_14495 pLX_304 0% 99.7% 99.6% V5 4C>G;435T>C n/a
5 TRCN0000479918 ATTTTATCCCTTGATTGCTTAGGA pLX_317 38.6% 99.7% 99.6% V5 4C>G;435T>C n/a
Download CSV