Transcript: Human NM_001283055.2

Homo sapiens stathmin 4 (STMN4), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-09-29
Taxon:
Homo sapiens (human)
Gene:
STMN4 (81551)
Length:
2203
CDS:
69..572

Additional Resources:

NCBI RefSeq record:
NM_001283055.2
NBCI Gene record:
STMN4 (81551)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001283055.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000160451 CTGAATAAGTCGTCCTACAAA pLKO.1 123 CDS 100% 5.625 7.875 N STMN4 n/a
2 TRCN0000162711 CATTTCCGACATGGAAGTCAT pLKO.1 179 CDS 100% 4.950 6.930 N STMN4 n/a
3 TRCN0000164407 CTAGCAGAGAAACGGGAACAT pLKO.1 387 CDS 100% 4.950 3.960 N STMN4 n/a
4 TRCN0000160910 GAAGTCATCGAGCTGAACAAA pLKO.1 192 CDS 100% 5.625 3.938 N STMN4 n/a
5 TRCN0000160167 CAACTTCATCAAGATGGCTAA pLKO.1 446 CDS 100% 4.050 2.835 N STMN4 n/a
6 TRCN0000164435 CCCAGAAGATGGAATCCAACA pLKO.1 478 CDS 100% 4.050 2.835 N STMN4 n/a
7 TRCN0000163346 GCCAAAGAACTTTCCAGGTCA pLKO.1 675 3UTR 100% 2.640 1.848 N STMN4 n/a
8 TRCN0000163179 GACCAGTGAAGCCATCCTATT pLKO.1 830 3UTR 100% 10.800 6.480 N STMN4 n/a
9 TRCN0000163424 GAGAGGAGAGAGTTTGGGAAA pLKO.1 885 3UTR 100% 4.050 2.430 N STMN4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001283055.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04236 pDONR223 100% 76.4% 75% None (many diffs) n/a
2 ccsbBroad304_04236 pLX_304 0% 76.4% 75% V5 (many diffs) n/a
3 TRCN0000472188 TTGCTGTTCCCCCGCACCTGTGTG pLX_317 58.6% 76.4% 75% V5 (many diffs) n/a
Download CSV