Transcript: Human NM_001284244.2

Homo sapiens prepronociceptin (PNOC), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
PNOC (5368)
Length:
1004
CDS:
209..547

Additional Resources:

NCBI RefSeq record:
NM_001284244.2
NBCI Gene record:
PNOC (5368)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001284244.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000152361 CCTCTAGCTACCATTTCAATA pLKO.1 803 3UTR 100% 13.200 18.480 N PNOC n/a
2 TRCN0000151760 CAGTGAGTTTATGAGGCAATA pLKO.1 463 CDS 100% 10.800 15.120 N PNOC n/a
3 TRCN0000219942 CAGAACCTTCCCGTCTGATTG pLKO.1 714 3UTR 100% 10.800 7.560 N PNOC n/a
4 TRCN0000155758 CAGAAGCGGTTCAGTGAGTTT pLKO.1 452 CDS 100% 4.950 3.465 N PNOC n/a
5 TRCN0000156106 CAATACTTGGTCCTGAGCATG pLKO.1 479 CDS 100% 4.050 2.835 N PNOC n/a
6 TRCN0000151410 GTTTATGAGGCAATACTTGGT pLKO.1 469 CDS 100% 2.640 1.848 N PNOC n/a
7 TRCN0000106567 GAAGCGGTTCAGTGAGTTTAT pLKO.1 454 CDS 100% 13.200 7.920 N Pnoc n/a
8 TRCN0000155223 GAAGCAGCTGCAGAAGAGATT pLKO.1 385 CDS 100% 4.950 2.970 N PNOC n/a
9 TRCN0000153020 GCACCAGAATGGTAATGTGTA pLKO.1 526 CDS 100% 4.950 2.970 N PNOC n/a
10 TRCN0000154902 GCAATACTTGGTCCTGAGCAT pLKO.1 478 CDS 100% 2.640 1.584 N PNOC n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001284244.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01226 pDONR223 100% 63.6% 63.6% None 0_1ins192 n/a
2 ccsbBroad304_01226 pLX_304 0% 63.6% 63.6% V5 0_1ins192 n/a
3 TRCN0000468662 GGACCCTTACTTCTTAAAGTAAAT pLX_317 62.4% 63.6% 63.6% V5 0_1ins192 n/a
Download CSV