Transcript: Mouse NM_001284393.1

Mus musculus guanine nucleotide binding protein (G protein), gamma transducing activity polypeptide 2 (Gngt2), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Gngt2 (14710)
Length:
590
CDS:
242..451

Additional Resources:

NCBI RefSeq record:
NM_001284393.1
NBCI Gene record:
Gngt2 (14710)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001284393.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000037087 CAAAGGCATCCCAGAAGACAA pLKO.1 391 CDS 100% 4.950 3.465 N Gngt2 n/a
2 TRCN0000037085 CCTTCAAGGAGAAAGGCACTT pLKO.1 417 CDS 100% 4.050 2.835 N Gngt2 n/a
3 TRCN0000037084 CCCACGTGATCTGATTTCCAA pLKO.1 313 CDS 100% 3.000 2.100 N Gngt2 n/a
4 TRCN0000037088 GCAGCTGAAGAAGGAAGTGAA pLKO.1 289 CDS 100% 4.950 2.970 N Gngt2 n/a
5 TRCN0000037086 GATTATGTAGAGGCCCAAGCA pLKO.1 353 CDS 100% 2.640 1.584 N Gngt2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001284393.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00661 pDONR223 100% 85% 82.6% None (many diffs) n/a
2 ccsbBroad304_00661 pLX_304 0% 85% 82.6% V5 (many diffs) n/a
3 TRCN0000466593 CAATGATTTCAGCATGCTAGCCTA pLX_317 100% 85% 82.6% V5 (many diffs) n/a
Download CSV