Transcript: Human NM_001284407.2

Homo sapiens transmembrane protein 40 (TMEM40), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-06-16
Taxon:
Homo sapiens (human)
Gene:
TMEM40 (55287)
Length:
1935
CDS:
78..689

Additional Resources:

NCBI RefSeq record:
NM_001284407.2
NBCI Gene record:
TMEM40 (55287)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001284407.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000244587 ACCAAATGTGGCGGTACATAC pLKO_005 1385 3UTR 100% 10.800 15.120 N TMEM40 n/a
2 TRCN0000257047 GAAACCGTTGGCATCTACTTC pLKO_005 579 CDS 100% 4.950 6.930 N TMEM40 n/a
3 TRCN0000244586 CAGTTAAGAAGACTGAATATA pLKO_005 429 CDS 100% 15.000 10.500 N TMEM40 n/a
4 TRCN0000244588 GCTGGTGTGTTATCACTATTA pLKO_005 506 CDS 100% 13.200 9.240 N TMEM40 n/a
5 TRCN0000244589 AGGATGAGCTTCAACTCTATG pLKO_005 319 CDS 100% 10.800 7.560 N TMEM40 n/a
6 TRCN0000172946 GCAGACTGGTTCATGTCTCTT pLKO.1 528 CDS 100% 4.950 3.465 N TMEM40 n/a
7 TRCN0000168682 GAGCTTCAACTCTATGGAGAT pLKO.1 324 CDS 100% 4.050 2.835 N TMEM40 n/a
8 TRCN0000176441 CCTCTCAGTTAAGAAGACTGA pLKO.1 424 CDS 100% 0.264 0.185 N Tmem40 n/a
9 TRCN0000434454 AGACCAACCTGGGCAACATAG pLKO_005 1331 3UTR 100% 10.800 5.400 Y SULT1A1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001284407.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12199 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_12199 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000474604 AGAAGAAAATGCAGTGCTGTTGTC pLX_317 51.8% 100% 100% V5 n/a
Download CSV