Transcript: Mouse NM_001284522.1

Mus musculus La ribonucleoprotein domain family, member 4 (Larp4), transcript variant 4, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Larp4 (207214)
Length:
6550
CDS:
203..2356

Additional Resources:

NCBI RefSeq record:
NM_001284522.1
NBCI Gene record:
Larp4 (207214)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001284522.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000252017 ATGCTTGTGTTGGCAATATAT pLKO_005 5778 3UTR 100% 15.000 10.500 N Larp4 n/a
2 TRCN0000252016 CCAAGTCATAAGCGATGTATT pLKO_005 764 CDS 100% 13.200 9.240 N Larp4 n/a
3 TRCN0000252018 CTAAGAATGGTTATCGATTAA pLKO_005 1020 CDS 100% 13.200 9.240 N Larp4 n/a
4 TRCN0000252015 GAATGTCTGATGTCGTTAAAG pLKO_005 1689 CDS 100% 13.200 9.240 N Larp4 n/a
5 TRCN0000258178 GTGATCAGTTCGTCCCAATAT pLKO_005 627 CDS 100% 13.200 9.240 N Larp4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001284522.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13020 pDONR223 100% 45.6% 44.8% None (many diffs) n/a
2 ccsbBroad304_13020 pLX_304 0% 45.6% 44.8% V5 (many diffs) n/a
3 TRCN0000467269 GATAATGCTGATCCTGAGGGTGGA pLX_317 40.6% 45.6% 44.8% V5 (many diffs) n/a
4 ccsbBroadEn_13021 pDONR223 100% 23.6% 23.5% None (many diffs) n/a
5 ccsbBroad304_13021 pLX_304 0% 23.6% 23.5% V5 (many diffs) n/a
6 TRCN0000479126 CATTTTTATGGCAGGAAGATCATG pLX_317 73.6% 23.6% 23.5% V5 (many diffs) n/a
Download CSV