Transcript: Mouse NM_001285416.1

Mus musculus brain derived neurotrophic factor (Bdnf), transcript variant 5, mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Bdnf (12064)
Length:
4078
CDS:
438..1187

Additional Resources:

NCBI RefSeq record:
NM_001285416.1
NBCI Gene record:
Bdnf (12064)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001285416.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000065383 GCCCTTACTATGGATAGCAAA pLKO.1 1092 CDS 100% 4.950 6.930 N Bdnf n/a
2 TRCN0000065385 GAAGTAAACGTCCACGGACAA pLKO.1 504 CDS 100% 4.050 5.670 N Bdnf n/a
3 TRCN0000065384 GCAGTATTTCTACGAGACCAA pLKO.1 977 CDS 100% 2.640 3.696 N Bdnf n/a
4 TRCN0000371421 ACAGTGGTTCTACAATCTATT pLKO_005 1315 3UTR 100% 13.200 9.240 N BDNF n/a
5 TRCN0000218717 ACTATCCATTCTGGTTGATAA pLKO_005 1835 3UTR 100% 13.200 9.240 N Bdnf n/a
6 TRCN0000225731 GAATTGGCTGGCGATTCATAA pLKO_005 1117 CDS 100% 13.200 9.240 N Bdnf n/a
7 TRCN0000371395 GAATTGGCTGGCGATTCATAA pLKO_005 1117 CDS 100% 13.200 9.240 N BDNF n/a
8 TRCN0000225730 TGAGCGTGTGTGACAGTATTA pLKO_005 856 CDS 100% 13.200 9.240 N Bdnf n/a
9 TRCN0000219099 TTCTACGAGACCAAGTGTAAT pLKO_005 984 CDS 100% 13.200 9.240 N Bdnf n/a
10 TRCN0000065386 TCCTAGAGAAAGTCCCGGTAT pLKO.1 940 CDS 100% 4.050 2.835 N Bdnf n/a
11 TRCN0000065387 CCAAGTGTAATCCCATGGGTT pLKO.1 994 CDS 100% 2.640 1.848 N Bdnf n/a
12 TRCN0000225729 TTTCCTTACTATGGTTATTTC pLKO_005 449 CDS 100% 13.200 7.920 N Bdnf n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001285416.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05886 pDONR223 100% 91.1% 96.3% None (many diffs) n/a
2 ccsbBroad304_05886 pLX_304 0% 91.1% 96.3% V5 (many diffs) n/a
3 TRCN0000492149 TTAGCTCCGTGCCGCGATATGAAA pLX_317 55.5% 91.1% 96.3% V5 (many diffs) n/a
Download CSV