Transcript: Mouse NM_001285426.1

Mus musculus calcium channel, voltage-dependent, beta 4 subunit (Cacnb4), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-04-09
Taxon:
Mus musculus (mouse)
Gene:
Cacnb4 (12298)
Length:
7792
CDS:
115..1623

Additional Resources:

NCBI RefSeq record:
NM_001285426.1
NBCI Gene record:
Cacnb4 (12298)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001285426.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000069161 CCGCCTGAAATGTTTGATGTT pLKO.1 1171 CDS 100% 4.950 6.930 N Cacnb4 n/a
2 TRCN0000069162 CGAAGTCCAAACCTGTAGCTT pLKO.1 323 CDS 100% 3.000 4.200 N Cacnb4 n/a
3 TRCN0000044090 GCGGAAGTACAAAGTGAAATT pLKO.1 928 CDS 100% 13.200 9.240 N CACNB4 n/a
4 TRCN0000069160 CCCACAGCAATCTCTGGATTA pLKO.1 1339 CDS 100% 10.800 7.560 N Cacnb4 n/a
5 TRCN0000069159 GCCAAGGACTTTCTTCACATT pLKO.1 424 CDS 100% 4.950 3.465 N Cacnb4 n/a
6 TRCN0000069158 GCTGATTAAGTCCAGAGGAAA pLKO.1 1092 CDS 100% 4.950 2.970 N Cacnb4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001285426.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00202 pDONR223 100% 86.2% 95.1% None (many diffs) n/a
2 ccsbBroad304_00202 pLX_304 0% 86.2% 95.1% V5 (many diffs) n/a
3 TRCN0000476597 TATGCGGCAACACTGTTGCCTGAA pLX_317 24.4% 86.2% 95.1% V5 (many diffs) n/a
Download CSV