Transcript: Mouse NM_001285438.1

Mus musculus RNA binding protein, fox-1 homolog (C. elegans) 3 (Rbfox3), transcript variant 6, mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Rbfox3 (52897)
Length:
2813
CDS:
393..1334

Additional Resources:

NCBI RefSeq record:
NM_001285438.1
NBCI Gene record:
Rbfox3 (52897)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001285438.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000254935 GCGGCAAATGTTCGGGCAATT pLKO_005 737 CDS 100% 10.800 15.120 N Rbfox3 n/a
2 TRCN0000427693 GCGGCAAATGTTCGGGCAATT pLKO_005 737 CDS 100% 10.800 15.120 N RBFOX3 n/a
3 TRCN0000254936 GGATAGGTGGAGTAGGGTTAA pLKO_005 2430 3UTR 100% 10.800 15.120 N Rbfox3 n/a
4 TRCN0000427232 GTCGTGTATCAGGATGGATTT pLKO_005 1149 CDS 100% 10.800 8.640 N RBFOX3 n/a
5 TRCN0000267515 CGTGCTGTGTATAATACATTT pLKO_005 1086 CDS 100% 13.200 9.240 N Rbfox3 n/a
6 TRCN0000196230 GAACAGTCTATGGGCCTGAAT pLKO.1 985 CDS 100% 4.950 3.465 N Rbfox3 n/a
7 TRCN0000254934 TTCTATGCAGTGACCAGTTTC pLKO_005 1005 CDS 100% 10.800 6.480 N Rbfox3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001285438.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.