Transcript: Mouse NM_001285948.1

Mus musculus cytochrome P450, family 39, subfamily a, polypeptide 1 (Cyp39a1), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Cyp39a1 (56050)
Length:
3017
CDS:
238..1452

Additional Resources:

NCBI RefSeq record:
NM_001285948.1
NBCI Gene record:
Cyp39a1 (56050)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001285948.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000329415 CACGTCAATACAGTCCAAATT pLKO_005 1016 CDS 100% 13.200 18.480 N Cyp39a1 n/a
2 TRCN0000353556 CTTGGAAATCTTAGGCTTATT pLKO_005 1979 3UTR 100% 13.200 10.560 N Cyp39a1 n/a
3 TRCN0000174980 GCCGGATTGAATATAAACAAA pLKO.1 1533 3UTR 100% 5.625 4.500 N Cyp39a1 n/a
4 TRCN0000329414 ATTCTGGACACTTGGATATAT pLKO_005 1086 CDS 100% 15.000 10.500 N Cyp39a1 n/a
5 TRCN0000216220 CATTCTGGACACTTGGATATA pLKO.1 1085 CDS 100% 13.200 9.240 N Cyp39a1 n/a
6 TRCN0000174798 GCATTATCTTAGTGCTGTATA pLKO.1 1431 CDS 100% 13.200 9.240 N Cyp39a1 n/a
7 TRCN0000174687 GCTCTCTTAGAGATTCAACTA pLKO.1 1409 CDS 100% 4.950 3.465 N Cyp39a1 n/a
8 TRCN0000329413 GCTCTCTTAGAGATTCAACTA pLKO_005 1409 CDS 100% 4.950 3.465 N Cyp39a1 n/a
9 TRCN0000174688 GAAGAAGGAATCAATGTGCTT pLKO.1 481 CDS 100% 2.640 1.848 N Cyp39a1 n/a
10 TRCN0000329412 GAAGAAGGAATCAATGTGCTT pLKO_005 481 CDS 100% 2.640 1.848 N Cyp39a1 n/a
11 TRCN0000194209 GCAGTCTCATTATGTCTGGTT pLKO.1 2267 3UTR 100% 2.640 1.848 N Cyp39a1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001285948.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.