Transcript: Mouse NM_001286009.1

Mus musculus tubulin, gamma complex associated protein 2 (Tubgcp2), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Tubgcp2 (74237)
Length:
2894
CDS:
365..2692

Additional Resources:

NCBI RefSeq record:
NM_001286009.1
NBCI Gene record:
Tubgcp2 (74237)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001286009.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000120805 GTAGCCAAAGAAATCATCTAT pLKO.1 1775 CDS 100% 5.625 3.938 N Tubgcp2 n/a
2 TRCN0000120803 GCCTCTAAGATGTCCACACAA pLKO.1 740 CDS 100% 4.950 3.465 N Tubgcp2 n/a
3 TRCN0000120802 GCGTTCAATTATGCCAGCAAA pLKO.1 1835 CDS 100% 4.950 3.465 N Tubgcp2 n/a
4 TRCN0000140959 CAGCAGTCTCTGGAACTTAAA pLKO.1 815 CDS 100% 13.200 18.480 N TUBGCP2 n/a
5 TRCN0000140549 GCAGCAGTCTCTGGAACTTAA pLKO.1 814 CDS 100% 13.200 9.240 N TUBGCP2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001286009.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07689 pDONR223 100% 75% 79.1% None (many diffs) n/a
2 ccsbBroad304_07689 pLX_304 0% 75% 79.1% V5 (many diffs) n/a
3 TRCN0000477016 CCGGCCGTAATACAAAGCCAGACC pLX_317 17.5% 75% 79.1% V5 (many diffs) n/a
Download CSV