Transcript: Mouse NM_001286062.1

Mus musculus angiopoietin 1 (Angpt1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-22
Taxon:
Mus musculus (mouse)
Gene:
Angpt1 (11600)
Length:
4313
CDS:
517..2010

Additional Resources:

NCBI RefSeq record:
NM_001286062.1
NBCI Gene record:
Angpt1 (11600)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001286062.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000068218 CCCAGGTACTAAATCAAACAT pLKO.1 965 CDS 100% 5.625 7.875 N Angpt1 n/a
2 TRCN0000068221 GCTGCCATTCTGACTCACATA pLKO.1 547 CDS 100% 4.950 3.465 N Angpt1 n/a
3 TRCN0000068222 GCTTGGTTTCTCGTCAGACAT pLKO.1 1178 CDS 100% 4.950 3.465 N Angpt1 n/a
4 TRCN0000068220 CCCTTCCAATCTAAATGGAAT pLKO.1 1872 CDS 100% 0.495 0.347 N Angpt1 n/a
5 TRCN0000058638 CCCAGGTACTAAATCAAACTT pLKO.1 965 CDS 100% 5.625 7.875 N ANGPT1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001286062.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10677 pDONR223 100% 27.3% 28.9% None (many diffs) n/a
2 ccsbBroad304_10677 pLX_304 0% 27.3% 28.9% V5 (many diffs) n/a
3 TRCN0000475147 TCATGCGTAATGATATACTCGCGC pLX_317 98.2% 27.3% 28.9% V5 (many diffs) n/a
Download CSV