Transcript: Human NM_001286152.2

Homo sapiens myelin protein zero like 3 (MPZL3), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
MPZL3 (196264)
Length:
3947
CDS:
72..743

Additional Resources:

NCBI RefSeq record:
NM_001286152.2
NBCI Gene record:
MPZL3 (196264)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001286152.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000137252 GCAGCCACACAGTATCAATAT pLKO.1 259 CDS 100% 13.200 18.480 N MPZL3 n/a
2 TRCN0000414102 GGACCATAGCGATGGACAATC pLKO_005 839 3UTR 100% 10.800 15.120 N MPZL3 n/a
3 TRCN0000134813 CATAAAGGACAATGGGACATT pLKO.1 392 CDS 100% 4.950 3.960 N MPZL3 n/a
4 TRCN0000413087 GGGATGCATCTATAAGTATAA pLKO_005 361 CDS 100% 13.200 9.240 N MPZL3 n/a
5 TRCN0000427248 GCACATTTCGGGATCGGATTT pLKO_005 316 CDS 100% 10.800 7.560 N MPZL3 n/a
6 TRCN0000167873 GAGATCATCAGTAAAGACTTT pLKO.1 863 3UTR 100% 4.950 3.465 N MPZL3 n/a
7 TRCN0000137142 CCATAAAGGACAATGGGACAT pLKO.1 391 CDS 100% 4.050 2.835 N MPZL3 n/a
8 TRCN0000137304 GAGTCACCTAAAGACAGGAAA pLKO.1 767 3UTR 100% 4.950 2.970 N MPZL3 n/a
9 TRCN0000008902 CCTCCCAAAGTGTTGGGATTA pLKO.1 1745 3UTR 100% 1.080 0.540 Y GPR83 n/a
10 TRCN0000156315 CCTCCCAAAGTGTTGGGATTA pLKO.1 1745 3UTR 100% 1.080 0.540 Y MYORG n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001286152.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.