Transcript: Human NM_001286229.1

Homo sapiens denticleless E3 ubiquitin protein ligase homolog (DTL), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
DTL (51514)
Length:
4381
CDS:
922..2301

Additional Resources:

NCBI RefSeq record:
NM_001286229.1
NBCI Gene record:
DTL (51514)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001286229.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000118815 CTGGTGAACTTAAACTTGTTA pLKO.1 535 5UTR 100% 5.625 7.875 N DTL n/a
2 TRCN0000118813 GCCTAGTAACAGTAACGAGTA pLKO.1 1364 CDS 100% 4.050 5.670 N DTL n/a
3 TRCN0000289128 GCCTAGTAACAGTAACGAGTA pLKO_005 1364 CDS 100% 4.050 5.670 N DTL n/a
4 TRCN0000118816 GCTCCCAATATGGAACATGTA pLKO.1 390 5UTR 100% 4.950 3.960 N DTL n/a
5 TRCN0000289183 GCTCCCAATATGGAACATGTA pLKO_005 390 5UTR 100% 4.950 3.960 N DTL n/a
6 TRCN0000194041 GTCTGGAGAGTGTGAAACAAA pLKO.1 1784 CDS 100% 5.625 3.938 N Dtl n/a
7 TRCN0000118812 CCGAGGATGAATGCTGTGTTT pLKO.1 2501 3UTR 100% 4.950 3.465 N DTL n/a
8 TRCN0000306820 CCGAGGATGAATGCTGTGTTT pLKO_005 2501 3UTR 100% 4.950 3.465 N DTL n/a
9 TRCN0000118814 CCTGGTGAACTTAAACTTGTT pLKO.1 534 5UTR 100% 4.950 3.465 N DTL n/a
10 TRCN0000289182 CCTGGTGAACTTAAACTTGTT pLKO_005 534 5UTR 100% 4.950 3.465 N DTL n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001286229.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08305 pDONR223 100% 62.7% 62.7% None 1_1delAins814;3G>T n/a
2 ccsbBroad304_08305 pLX_304 0% 62.7% 62.7% V5 1_1delAins814;3G>T n/a
3 TRCN0000468134 CGGGTGGCTTCCCGTGTACTAGGC pLX_317 15.3% 62.7% 62.7% V5 1_1delAins814;3G>T n/a
4 ccsbBroadEn_08304 pDONR223 100% 62.7% 62.7% None 1_1delAins814;3G>T;1374A>G n/a
5 ccsbBroad304_08304 pLX_304 0% 62.7% 62.7% V5 1_1delAins814;3G>T;1374A>G n/a
6 TRCN0000479477 CTCAAAAGTCGCGCGGGCAAACGG pLX_317 15.3% 62.7% 62.7% V5 1_1delAins814;3G>T;1374A>G n/a
Download CSV