Transcript: Human NM_001286358.2

Homo sapiens protamine 2 (PRM2), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-09-29
Taxon:
Homo sapiens (human)
Gene:
PRM2 (5620)
Length:
673
CDS:
111..482

Additional Resources:

NCBI RefSeq record:
NM_001286358.2
NBCI Gene record:
PRM2 (5620)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001286358.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000122506 CCAGCTGGAAGTTAAGAGAAA pLKO.1 512 3UTR 100% 4.950 3.465 N PRM2 n/a
2 TRCN0000195797 CCAGGAAGAGAACATGCAGAA pLKO.1 384 CDS 100% 4.050 2.835 N PRM2 n/a
3 TRCN0000184493 GAGAACATGCAGAAGGCACTA pLKO.1 391 CDS 100% 4.050 2.835 N PRM2 n/a
4 TRCN0000122505 CAGTTGCATGGGCAAGAGCAA pLKO.1 168 CDS 100% 2.640 1.848 N PRM2 n/a
5 TRCN0000184521 GAACCAGGAAGAGAACATGCA pLKO.1 381 CDS 100% 2.640 1.848 N PRM2 n/a
6 TRCN0000122626 GAGGTCTACGAGAGGACCCAT pLKO.1 234 CDS 100% 0.880 0.616 N PRM2 n/a
7 TRCN0000184320 GAAGAGAACATGCAGAAGGCA pLKO.1 388 CDS 100% 0.750 0.525 N PRM2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001286358.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01296 pDONR223 100% 79.5% 71.3% None 269_270insAGGCTGC;300_369del n/a
2 ccsbBroad304_01296 pLX_304 0% 79.5% 71.3% V5 269_270insAGGCTGC;300_369del n/a
3 TRCN0000472014 CAAATCTATAATCTGGGATGACCC pLX_317 100% 79.5% 71.3% V5 269_270insAGGCTGC;300_369del n/a
Download CSV