Transcript: Human NM_001286470.1

Homo sapiens D-glutamate cyclase (DGLUCY), transcript variant 6, mRNA.

Source:
NCBI, updated 2018-12-16
Taxon:
Homo sapiens (human)
Gene:
DGLUCY (80017)
Length:
3476
CDS:
1048..2913

Additional Resources:

NCBI RefSeq record:
NM_001286470.1
NBCI Gene record:
DGLUCY (80017)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001286470.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000236477 AGACGCAGATCCCGATATTAA pLKO_005 2252 CDS 100% 15.000 21.000 N DGLUCY n/a
2 TRCN0000236480 GGCGACAATCCTGCTAGTAAA pLKO_005 2987 3UTR 100% 13.200 18.480 N DGLUCY n/a
3 TRCN0000130152 CGTCGGTCATTAAGGAAGAAA pLKO.1 2750 CDS 100% 5.625 7.875 N DGLUCY n/a
4 TRCN0000130002 GCAGATCCCGATATTAACTTA pLKO.1 2256 CDS 100% 5.625 7.875 N DGLUCY n/a
5 TRCN0000236478 ACGAGCTTGGGATGGGTAAAG pLKO_005 2510 CDS 100% 10.800 8.640 N DGLUCY n/a
6 TRCN0000236479 GGAGAAGGAGGTCGCCATAAT pLKO_005 2163 CDS 100% 13.200 9.240 N DGLUCY n/a
7 TRCN0000236481 ACCCGCAGACACCTAGATTTG pLKO_005 2327 CDS 100% 10.800 7.560 N DGLUCY n/a
8 TRCN0000128191 CATCAGAAATACATCCAGCAT pLKO.1 1122 CDS 100% 2.640 1.848 N DGLUCY n/a
9 TRCN0000127871 GCGTTGATTTCAACCCTCCTT pLKO.1 3150 3UTR 100% 2.640 1.848 N DGLUCY n/a
10 TRCN0000127795 GCTCTGTAAAGATGAGCTGCT pLKO.1 2004 CDS 100% 2.160 1.512 N DGLUCY n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001286470.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08998 pDONR223 100% 99.1% 99.1% None 306C>T;440_454del n/a
2 ccsbBroad304_08998 pLX_304 0% 99.1% 99.1% V5 306C>T;440_454del n/a
3 TRCN0000466769 GCAAAGACAAACACCGCACCCCCC pLX_317 22.4% 99.1% 99.1% V5 306C>T;440_454del n/a
4 ccsbBroadEn_12661 pDONR223 100% 22.7% 16.7% None (many diffs) n/a
5 ccsbBroad304_12661 pLX_304 0% 22.7% 16.7% V5 (many diffs) n/a
Download CSV