Transcript: Human NM_001286516.1

Homo sapiens DnaJ heat shock protein family (Hsp40) member A3 (DNAJA3), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-09-03
Taxon:
Homo sapiens (human)
Gene:
DNAJA3 (9093)
Length:
2314
CDS:
188..1090

Additional Resources:

NCBI RefSeq record:
NM_001286516.1
NBCI Gene record:
DNAJA3 (9093)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001286516.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000008776 TCCGACCTCTTTATTTCTATA pLKO.1 770 CDS 100% 13.200 18.480 N DNAJA3 n/a
2 TRCN0000285070 TCCGACCTCTTTATTTCTATA pLKO_005 770 CDS 100% 13.200 18.480 N DNAJA3 n/a
3 TRCN0000008774 GCATCAAGTTACGAAGTGATT pLKO.1 1438 3UTR 100% 4.950 3.465 N DNAJA3 n/a
4 TRCN0000285073 GCATCAAGTTACGAAGTGATT pLKO_005 1438 3UTR 100% 4.950 3.465 N DNAJA3 n/a
5 TRCN0000008775 GCGAGTTCTCATCCTCTTCAT pLKO.1 300 CDS 100% 4.950 3.465 N DNAJA3 n/a
6 TRCN0000273884 GCGAGTTCTCATCCTCTTCAT pLKO_005 300 CDS 100% 4.950 3.465 N DNAJA3 n/a
7 TRCN0000011468 CCGGATTAACAGCTACGGCTA pLKO.1 910 CDS 100% 2.160 1.512 N DNAJA3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001286516.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15654 pDONR223 0% 80.2% 80.3% None 1_177del;624T>A n/a
2 ccsbBroad304_15654 pLX_304 0% 80.2% 80.3% V5 1_177del;624T>A n/a
3 TRCN0000481090 GACTTAATAATGTGACAGCCACTA pLX_317 60.9% 80.2% 80.3% V5 1_177del;624T>A n/a
4 ccsbBroadEn_15655 pDONR223 0% 66% 60% None (many diffs) n/a
5 ccsbBroad304_15655 pLX_304 0% 66% 60% V5 (many diffs) n/a
6 ccsbBroadEn_07358 pDONR223 100% 61.8% 55.8% None (many diffs) n/a
7 ccsbBroad304_07358 pLX_304 0% 61.8% 55.8% V5 (many diffs) n/a
8 TRCN0000491448 CCATTGCGAACCTGAGTTGGGCCC pLX_317 21.3% 61.8% 55.8% V5 (many diffs) n/a
Download CSV