Transcript: Mouse NM_001286518.1

Mus musculus AHNAK nucleoprotein (desmoyokin) (Ahnak), transcript variant 4, mRNA.

Source:
NCBI, updated 2018-09-02
Taxon:
Mus musculus (mouse)
Gene:
Ahnak (66395)
Length:
1145
CDS:
258..779

Additional Resources:

NCBI RefSeq record:
NM_001286518.1
NBCI Gene record:
Ahnak (66395)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001286518.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000104947 TGGCTTGAAGTTGCACCGTAA pLKO.1 506 CDS 100% 4.050 5.670 N Ahnak n/a
2 TRCN0000104946 GTGGTTCTGAACACGGTACAA pLKO.1 594 CDS 100% 4.950 3.960 N Ahnak n/a
3 TRCN0000104949 TGGACTGCAATGACCAGAATA pLKO.1 625 CDS 100% 13.200 9.240 N Ahnak n/a
4 TRCN0000296590 TGGGTGCCACCATCTACTTTG pLKO_005 427 CDS 100% 10.800 7.560 N AHNAK n/a
5 TRCN0000104945 GTGATTGTTCTTTGGAGCATT pLKO.1 845 3UTR 100% 4.950 3.465 N Ahnak n/a
6 TRCN0000104948 TGCCACCATCTACTTTGACAA pLKO.1 431 CDS 100% 4.950 3.465 N Ahnak n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001286518.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12531 pDONR223 100% 77.2% 78% None (many diffs) n/a
2 ccsbBroad304_12531 pLX_304 0% 77.2% 78% V5 (many diffs) n/a
3 TRCN0000471494 GCATGTACCGCGGGTTGGTACAGG pLX_317 67.8% 77.2% 78% V5 (many diffs) n/a
4 ccsbBroadEn_08907 pDONR223 100% 76.6% 76.8% None (many diffs) n/a
5 ccsbBroad304_08907 pLX_304 0% 76.6% 76.8% V5 (many diffs) n/a
6 TRCN0000467297 TGTATCTAGCGAGGTCCATGAACG pLX_317 71.3% 76.6% 76.8% V5 (many diffs) n/a
Download CSV