Transcript: Mouse NM_001286553.1

Mus musculus protein phosphatase 2, regulatory subunit A, beta (Ppp2r1b), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Ppp2r1b (73699)
Length:
3627
CDS:
62..2146

Additional Resources:

NCBI RefSeq record:
NM_001286553.1
NBCI Gene record:
Ppp2r1b (73699)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001286553.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000080840 GCTCCGTCTCAACAGTATTAA pLKO.1 175 CDS 100% 15.000 21.000 N Ppp2r1b n/a
2 TRCN0000080838 CCCTAACTACTTACACAGAAT pLKO.1 1573 CDS 100% 4.950 6.930 N Ppp2r1b n/a
3 TRCN0000341619 ATCAAATCCTGCCCTATATAA pLKO_005 1068 CDS 100% 15.000 12.000 N Ppp2r1b n/a
4 TRCN0000341550 TGTCCCATTGTTCACGAATTT pLKO_005 712 CDS 100% 13.200 10.560 N Ppp2r1b n/a
5 TRCN0000376209 ACCACGCTCTTCTGCATTAAT pLKO_005 1595 CDS 100% 15.000 10.500 N Ppp2r1b n/a
6 TRCN0000341552 GTGTCCAGAAGTTCGTTTAAA pLKO_005 1225 CDS 100% 15.000 10.500 N Ppp2r1b n/a
7 TRCN0000080841 CCCACAAAGTAAGAGAGCTTT pLKO.1 1005 CDS 100% 4.950 3.465 N Ppp2r1b n/a
8 TRCN0000080839 GCTGGGAAATTTCACTGGTTT pLKO.1 313 CDS 100% 4.950 3.465 N Ppp2r1b n/a
9 TRCN0000080842 CCAGAATACCATTGTCCCTAA pLKO.1 1531 CDS 100% 4.050 2.430 N Ppp2r1b n/a
10 TRCN0000010712 GCCACCAACAACCTCATGAAA pLKO.1 1481 CDS 100% 5.625 3.938 N PPP2R1B n/a
11 TRCN0000010716 CCTGGCTTGTGGATCATGTAT pLKO.1 1443 CDS 100% 5.625 3.375 N PPP2R1A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001286553.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13925 pDONR223 100% 84.4% 1% None (many diffs) n/a
2 ccsbBroad304_13925 pLX_304 0% 84.4% 1% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV