Transcript: Human NM_001286645.1

Homo sapiens adducin 1 (ADD1), transcript variant 5, mRNA.

Source:
NCBI, updated 2019-08-05
Taxon:
Homo sapiens (human)
Gene:
ADD1 (118)
Length:
4772
CDS:
864..2852

Additional Resources:

NCBI RefSeq record:
NM_001286645.1
NBCI Gene record:
ADD1 (118)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001286645.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000084019 CGGTGTAAATTGGCAGCGTTT pLKO.1 1299 CDS 100% 4.050 3.240 N ADD1 n/a
2 TRCN0000331219 CGGTGTAAATTGGCAGCGTTT pLKO_005 1299 CDS 100% 4.050 3.240 N ADD1 n/a
3 TRCN0000084022 GCAGAATTTACAGGACATTAA pLKO.1 2387 CDS 100% 13.200 9.240 N ADD1 n/a
4 TRCN0000310541 GCAGAATTTACAGGACATTAA pLKO_005 2387 CDS 100% 13.200 9.240 N ADD1 n/a
5 TRCN0000084021 GCCCTGCTTTCTGTGAAGAAT pLKO.1 1054 CDS 100% 5.625 3.938 N ADD1 n/a
6 TRCN0000300003 GCCCTGCTTTCTGTGAAGAAT pLKO_005 1054 CDS 100% 5.625 3.938 N ADD1 n/a
7 TRCN0000084018 GCAGGTTTACAATTTAGCTTA pLKO.1 3940 3UTR 100% 4.950 3.465 N ADD1 n/a
8 TRCN0000300074 GCAGGTTTACAATTTAGCTTA pLKO_005 3940 3UTR 100% 4.950 3.465 N ADD1 n/a
9 TRCN0000084020 GCAGGAATTTGAAGCCCTCAT pLKO.1 1985 CDS 100% 4.050 2.835 N ADD1 n/a
10 TRCN0000310542 GCAGGAATTTGAAGCCCTCAT pLKO_005 1985 CDS 100% 4.050 2.835 N ADD1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001286645.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13809 pDONR223 100% 60.3% 59.2% None 19G>T;1174_1315del;1343_1986del n/a
2 ccsbBroad304_13809 pLX_304 0% 60.3% 59.2% V5 19G>T;1174_1315del;1343_1986del n/a
3 TRCN0000471276 AGATAGCTCATTCCGGATCCTATA pLX_317 34% 60.3% 59.2% V5 19G>T;1174_1315del;1343_1986del n/a
Download CSV