Transcript: Human NM_001286657.2

Homo sapiens transmembrane protein 68 (TMEM68), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-05-01
Taxon:
Homo sapiens (human)
Gene:
TMEM68 (137695)
Length:
2573
CDS:
225..1199

Additional Resources:

NCBI RefSeq record:
NM_001286657.2
NBCI Gene record:
TMEM68 (137695)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001286657.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000370176 TTCCTGGATAATGCGTTAAAT pLKO_005 1506 3UTR 100% 15.000 21.000 N TMEM68 n/a
2 TRCN0000365123 CAGGATTCTGTGCCCTATATG pLKO_005 258 CDS 100% 13.200 18.480 N TMEM68 n/a
3 TRCN0000147520 GCCCTAATTAGTGATGAAACT pLKO.1 831 CDS 100% 4.950 6.930 N TMEM68 n/a
4 TRCN0000370175 GAGTAGTAGCTGATCACTTTG pLKO_005 682 CDS 100% 10.800 8.640 N TMEM68 n/a
5 TRCN0000147296 GAGTGCTTTGTTAGAACGTTT pLKO.1 1172 CDS 100% 4.950 3.960 N TMEM68 n/a
6 TRCN0000128075 GAGTTCGAGAAGCCCTAATTA pLKO.1 820 CDS 100% 15.000 10.500 N TMEM68 n/a
7 TRCN0000377492 GAGCAGTTGGAGGACTATTTG pLKO_005 318 CDS 100% 13.200 9.240 N TMEM68 n/a
8 TRCN0000365124 GTAGGTCCTATAATTAGTATT pLKO_005 1278 3UTR 100% 13.200 9.240 N TMEM68 n/a
9 TRCN0000124568 TGCCCATTATTCCTATGTTTA pLKO.1 910 CDS 100% 13.200 9.240 N Tmem68 n/a
10 TRCN0000124565 CCGCTATCCATTTGCTCCAAT pLKO.1 1001 CDS 100% 4.950 3.465 N Tmem68 n/a
11 TRCN0000309306 CCGCTATCCATTTGCTCCAAT pLKO_005 1001 CDS 100% 4.950 3.465 N Tmem68 n/a
12 TRCN0000128172 CAGGAAACATTATGAGTGCTT pLKO.1 1159 CDS 100% 2.640 1.848 N TMEM68 n/a
13 TRCN0000147088 CCAGCCTGAATGATGAATTTA pLKO.1 2331 3UTR 100% 15.000 9.000 N TMEM68 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001286657.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13193 pDONR223 100% 40% 36.1% None (many diffs) n/a
2 ccsbBroad304_13193 pLX_304 0% 40% 36.1% V5 (many diffs) n/a
3 TRCN0000475274 AGTATTCTCGATTGGGTAATCACA pLX_317 74.1% 40% 36.1% V5 (many diffs) n/a
Download CSV