Transcript: Human NM_001286682.1

Homo sapiens aminoadipate aminotransferase (AADAT), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-02-24
Taxon:
Homo sapiens (human)
Gene:
AADAT (51166)
Length:
2120
CDS:
125..1414

Additional Resources:

NCBI RefSeq record:
NM_001286682.1
NBCI Gene record:
AADAT (51166)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001286682.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000035055 CCAGGTATTAGCACAACTTAT pLKO.1 1378 CDS 100% 13.200 9.240 N AADAT n/a
2 TRCN0000291300 CCAGGTATTAGCACAACTTAT pLKO_005 1378 CDS 100% 13.200 9.240 N AADAT n/a
3 TRCN0000035056 CCCTTAATAGAGAGAGTTATT pLKO.1 971 CDS 100% 13.200 9.240 N AADAT n/a
4 TRCN0000307657 CCCTTAATAGAGAGAGTTATT pLKO_005 971 CDS 100% 13.200 9.240 N AADAT n/a
5 TRCN0000035058 GCCAGTGATGAAAGTGGGATT pLKO.1 614 CDS 100% 4.050 2.835 N AADAT n/a
6 TRCN0000307661 GCCAGTGATGAAAGTGGGATT pLKO_005 614 CDS 100% 4.050 2.835 N AADAT n/a
7 TRCN0000035057 CCCTTACTTGAGAGCATCCTT pLKO.1 1321 CDS 100% 3.000 2.100 N AADAT n/a
8 TRCN0000291301 CCCTTACTTGAGAGCATCCTT pLKO_005 1321 CDS 100% 3.000 2.100 N AADAT n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001286682.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14139 pDONR223 100% 99.8% 99% None 320C>A;1279delG n/a
2 ccsbBroad304_14139 pLX_304 0% 99.8% 99% V5 (not translated due to frame shift) 320C>A;1279delG n/a
3 TRCN0000492234 GTCATGTGGGACACTTACTGTTTA pLX_317 26% 99% 98.8% V5 (not translated due to prior stop codon) 68_79del n/a
Download CSV