Transcript: Human NM_001286700.1

Homo sapiens RNA terminal phosphate cyclase like 1 (RCL1), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-07-05
Taxon:
Homo sapiens (human)
Gene:
RCL1 (10171)
Length:
2022
CDS:
557..1204

Additional Resources:

NCBI RefSeq record:
NM_001286700.1
NBCI Gene record:
RCL1 (10171)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001286700.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000078379 CGAATGGTTCTCGAATTGAAA pLKO.1 434 5UTR 100% 5.625 7.875 N RCL1 n/a
2 TRCN0000078382 GCATTGGTTTCTCCAACCTTA pLKO.1 1167 CDS 100% 4.950 6.930 N RCL1 n/a
3 TRCN0000445551 GAATAGCCACTTGCTTAATTT pLKO_005 1300 3UTR 100% 15.000 12.000 N RCL1 n/a
4 TRCN0000451297 CAATGGGACCAAGTCCAAATG pLKO_005 1264 3UTR 100% 10.800 8.640 N RCL1 n/a
5 TRCN0000440313 GGGATTGATGGTGAATCATTT pLKO_005 512 5UTR 100% 13.200 9.240 N RCL1 n/a
6 TRCN0000078378 CGGATCTTCATCTGGTTCATT pLKO.1 1771 3UTR 100% 5.625 3.938 N RCL1 n/a
7 TRCN0000222716 CTCTCCCTACACGATAGAATT pLKO.1 1042 CDS 100% 0.000 0.000 N RCL1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001286700.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02339 pDONR223 100% 57.6% 57.6% None 0_1ins474 n/a
2 ccsbBroad304_02339 pLX_304 0% 57.6% 57.6% V5 0_1ins474 n/a
3 TRCN0000467913 ATATATCGTAAGAGCATTCGAGTT pLX_317 32.7% 57.6% 57.6% V5 0_1ins474 n/a
Download CSV