Construct: ORF TRCN0000467913
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF013560.1_s317c1
- Derived from:
- ccsbBroadEn_02339
- DNA Barcode:
- ATATATCGTAAGAGCATTCGAGTT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- RCL1 (10171)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000467913
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 10171 | RCL1 | RNA terminal phosphate cycl... | NM_005772.5 | 100% | 100% | |
| 2 | human | 10171 | RCL1 | RNA terminal phosphate cycl... | XM_006716715.3 | 71% | 71% | 0_1ins324 |
| 3 | human | 10171 | RCL1 | RNA terminal phosphate cycl... | NM_001286699.1 | 57.6% | 57.6% | 0_1ins474 |
| 4 | human | 10171 | RCL1 | RNA terminal phosphate cycl... | NM_001286700.1 | 57.6% | 57.6% | 0_1ins474 |
| 5 | human | 10171 | RCL1 | RNA terminal phosphate cycl... | NM_001286701.1 | 49.3% | 47.9% | (many diffs) |
| 6 | human | 10171 | RCL1 | RNA terminal phosphate cycl... | XM_011517673.3 | 49.3% | 47.9% | (many diffs) |
| 7 | human | 10171 | RCL1 | RNA terminal phosphate cycl... | XM_017014176.1 | 49.3% | 47.9% | (many diffs) |
| 8 | mouse | 59028 | Rcl1 | RNA terminal phosphate cycl... | NM_021525.2 | 88.6% | 97% | (many diffs) |
| 9 | mouse | 59028 | Rcl1 | RNA terminal phosphate cycl... | XM_017318268.1 | 48.1% | 43.6% | (many diffs) |
| 10 | mouse | 59028 | Rcl1 | RNA terminal phosphate cycl... | XM_006527246.4 | 44.7% | 46.6% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1185
- ORF length:
- 1119
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc gactcaggcg cactccctca gctacgcagg gtgcaacttc ttgcgccaac 121 gtctggtcct gtctaccctg agcgggcgcc ccgtcaaaat ccgaaagatt cgggccagag 181 acgacaaccc gggcctccga gattttgaag ccagcttcat aaggctattg gacaaaataa 241 cgaatggttc tcgaattgaa ataaaccaaa caggaacaac cttatattat cagcctggcc 301 tcctgtatgg tggatctgtg gaacatgact gtagcgtcct tcgtggcatt gggtattacc 361 tggagagtct tctttgcttg gctccattta tgaagcaccc gttaaaaata gttctacgag 421 gagtgaccaa tgatcaggtt gacccttcag ttgatgttct taaggcaaca gcactccctt 481 tgttgaaaca atttgggatt gatggtgaat catttgaact gaagattgtg cgacggggaa 541 tgcctcccgg aggaggaggc gaagtggttt tctcatgtcc tgtgaggaag gtcttgaagc 601 ccattcaact cacagatcca ggaaaaatca aacgtattag aggaatggcg tactctgtac 661 gtgtgtcacc tcagatggcg aaccggattg tggattctgc aaggagcatc ctcaacaagt 721 tcatacctga tatctatatt tacacagatc acatgaaagg agtcaactct gggaagtctc 781 cgggctttgg gttgtcactg gttgctgaga ccaccagtgg caCCTTCCTC AGTGCTGAAC 841 TGGCCTCCAA CCCCCAGGGC CAGGGAGCAG CAGTACTTCC AGAGGACCTT GGCAGGAACT 901 GTGCCCGGCT GCTGCTGGAG GAAATCTACA GGGGTGGATG CGTAGACTCG ACCAACCAAA 961 GCCTGGCGCT ACTACTCATG ACCCTTGGAC AGCAGGATGT TTCCAAAGTC CTGCTAGGCC 1021 CTCTCTCTCC CTACACGATA GAATTTTTGC GGCATTTGAA GAGCTTTTTC CAGATTATGT 1081 TTAAAATTGA AACCAAGCCA TGTGGTGAAG AACTCAAGGG TGGGGATAAA GTGCTGATGA 1141 CCTGTGTTGG CATTGGTTTC TCCAACCTTA GCAAGACCCT CAAGTGCCCA ACTTTCTTGT 1201 ACAAAGTGGT TGATATCGGT AAGCCTATCC CTAACCCTCT CCTCGGTCTC GATTCTACGT 1261 AGTAATGAAC TAGTCCGTAA CTTGAAAGTA TTTCGATTTC TTGGCTTTAT ATATCTTGTG 1321 GAAAGGACGA ATATATCGTA AGAGCATTCG AGTTACGCGT TAAGTCgaca atcaacctct 1381 ggattacaaa atttgtgaaa gatt