Transcript: Human NM_001286701.1

Homo sapiens RNA terminal phosphate cyclase like 1 (RCL1), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-07-06
Taxon:
Homo sapiens (human)
Gene:
RCL1 (10171)
Length:
1477
CDS:
96..659

Additional Resources:

NCBI RefSeq record:
NM_001286701.1
NBCI Gene record:
RCL1 (10171)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001286701.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000078382 GCATTGGTTTCTCCAACCTTA pLKO.1 622 CDS 100% 4.950 6.930 N RCL1 n/a
2 TRCN0000445551 GAATAGCCACTTGCTTAATTT pLKO_005 755 3UTR 100% 15.000 12.000 N RCL1 n/a
3 TRCN0000451297 CAATGGGACCAAGTCCAAATG pLKO_005 719 3UTR 100% 10.800 8.640 N RCL1 n/a
4 TRCN0000078378 CGGATCTTCATCTGGTTCATT pLKO.1 1226 3UTR 100% 5.625 3.938 N RCL1 n/a
5 TRCN0000222716 CTCTCCCTACACGATAGAATT pLKO.1 497 CDS 100% 0.000 0.000 N RCL1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001286701.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02339 pDONR223 100% 49.3% 47.9% None (many diffs) n/a
2 ccsbBroad304_02339 pLX_304 0% 49.3% 47.9% V5 (many diffs) n/a
3 TRCN0000467913 ATATATCGTAAGAGCATTCGAGTT pLX_317 32.7% 49.3% 47.9% V5 (many diffs) n/a
Download CSV