Transcript: Human NM_001286702.1

Homo sapiens armadillo repeat containing 1 (ARMC1), transcript variant 2, mRNA.

Source:
NCBI, updated 2018-06-30
Taxon:
Homo sapiens (human)
Gene:
ARMC1 (55156)
Length:
2861
CDS:
372..914

Additional Resources:

NCBI RefSeq record:
NM_001286702.1
NBCI Gene record:
ARMC1 (55156)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001286702.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000279613 TCTAGCAGCAGATCCGTTAAA pLKO_005 324 5UTR 100% 13.200 18.480 N ARMC1 n/a
2 TRCN0000279678 TGACGCTCTATCGGTAGTTAA pLKO_005 291 5UTR 100% 13.200 18.480 N ARMC1 n/a
3 TRCN0000279612 TTAGATTACACGATCGCATAT pLKO_005 1020 3UTR 100% 10.800 15.120 N ARMC1 n/a
4 TRCN0000149486 GTTAACCAGTTACGGGATCTA pLKO.1 307 5UTR 100% 4.950 6.930 N ARMC1 n/a
5 TRCN0000131099 GAGATGTTGGTCCCATTCCAA pLKO.1 720 CDS 100% 3.000 2.400 N ARMC1 n/a
6 TRCN0000279610 GAGATGTTGGTCCCATTCCAA pLKO_005 720 CDS 100% 3.000 2.400 N ARMC1 n/a
7 TRCN0000147693 GCTCAAGTTGTGCATGAATTA pLKO.1 1303 3UTR 100% 13.200 9.240 N ARMC1 n/a
8 TRCN0000128675 CAATAGCATCAACCAAGGTTA pLKO.1 661 CDS 100% 4.950 3.465 N ARMC1 n/a
9 TRCN0000130025 GCTTTGTACTCTTCACTGAAA pLKO.1 1363 3UTR 100% 4.950 3.465 N ARMC1 n/a
10 TRCN0000146648 CCGTGTTTATAGAAAGGACAT pLKO.1 1433 3UTR 100% 4.050 2.835 N ARMC1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001286702.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03537 pDONR223 100% 63.8% 47% None 0_1ins116;159_160ins190 n/a
2 ccsbBroad304_03537 pLX_304 0% 63.8% 47% V5 0_1ins116;159_160ins190 n/a
3 TRCN0000472769 GTTGGCAATCCCTGTACGTCTAAC pLX_317 20.4% 63.8% 47% V5 0_1ins116;159_160ins190 n/a
Download CSV