Transcript: Human NM_001286763.3

Homo sapiens rubicon like autophagy enhancer (RUBCNL), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-06-30
Taxon:
Homo sapiens (human)
Gene:
RUBCNL (80183)
Length:
3605
CDS:
172..1959

Additional Resources:

NCBI RefSeq record:
NM_001286763.3
NBCI Gene record:
RUBCNL (80183)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001286763.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000143065 CAGTGACTGAAACACGTACTT pLKO.1 821 CDS 100% 4.950 3.960 N RUBCNL n/a
2 TRCN0000121790 CTGGATACTGTCAGTAGTTAA pLKO.1 1029 CDS 100% 13.200 9.240 N RUBCNL n/a
3 TRCN0000122005 GAATGCAGATTCTGTGTTTAA pLKO.1 2116 3UTR 100% 13.200 9.240 N RUBCNL n/a
4 TRCN0000142340 CAGGGCTGATAGTTGTGGTTT pLKO.1 2140 3UTR 100% 4.950 3.465 N RUBCNL n/a
5 TRCN0000145606 CGTACTTACCATGATGTGAAA pLKO.1 835 CDS 100% 4.950 3.465 N RUBCNL n/a
6 TRCN0000143628 GCAGCTCTTCCATATCAAGAA pLKO.1 1551 CDS 100% 4.950 3.465 N RUBCNL n/a
7 TRCN0000142225 GCCAGAATACGACTGTCATCT pLKO.1 1790 CDS 100% 4.950 3.465 N RUBCNL n/a
8 TRCN0000144196 CTTCCATATCAAGAAGCTGTT pLKO.1 1557 CDS 100% 4.050 2.835 N RUBCNL n/a
9 TRCN0000141751 GTGTTTAAGCACAGGGCTGAT pLKO.1 2129 3UTR 100% 4.050 2.835 N RUBCNL n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001286763.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12679 pDONR223 100% 99.9% 99.8% None 253G>A n/a
2 ccsbBroad304_12679 pLX_304 0% 99.9% 99.8% V5 253G>A n/a
3 TRCN0000471489 TGCACCTAGTGGAAAACTCCAGCT pLX_317 27.8% 99.9% 99.8% V5 253G>A n/a
4 ccsbBroadEn_12680 pDONR223 99.5% 37% 33.8% None (many diffs) n/a
5 ccsbBroad304_12680 pLX_304 0% 37% 33.8% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV