Transcript: Human NM_001286957.2

Homo sapiens coiled-coil domain containing 65 (CCDC65), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
CCDC65 (85478)
Length:
1752
CDS:
594..1619

Additional Resources:

NCBI RefSeq record:
NM_001286957.2
NBCI Gene record:
CCDC65 (85478)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001286957.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000427532 GAGAACCGGTATATCCGTAAT pLKO_005 1029 CDS 100% 10.800 15.120 N CCDC65 n/a
2 TRCN0000130084 CCAAACATTTGAACGAGTGGT pLKO.1 419 5UTR 100% 2.640 3.696 N CCDC65 n/a
3 TRCN0000130516 GCAAGATATCTTCATGGCCAT pLKO.1 677 CDS 100% 2.160 3.024 N CCDC65 n/a
4 TRCN0000414055 ACGAGCCCAGCTGCTAGATAT pLKO_005 1427 CDS 100% 13.200 10.560 N CCDC65 n/a
5 TRCN0000420085 TCCTTAAACTTGCTGAAATAT pLKO_005 1201 CDS 100% 15.000 10.500 N CCDC65 n/a
6 TRCN0000129253 CCAAGGAGTTTGAGACAGAAA pLKO.1 613 CDS 100% 4.950 3.465 N CCDC65 n/a
7 TRCN0000130792 GCTGCTTCTGTTTCAGCAGAA pLKO.1 255 5UTR 100% 0.405 0.284 N CCDC65 n/a
8 TRCN0000127556 CCAGCTCAACCCACTCTTTAT pLKO.1 1517 CDS 100% 13.200 7.920 N CCDC65 n/a
9 TRCN0000414957 GACAATGTCATCAAGTCTTTA pLKO_005 450 5UTR 100% 13.200 7.920 N CCDC65 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001286957.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04485 pDONR223 100% 70.4% 70.4% None 0_1ins429 n/a
2 ccsbBroad304_04485 pLX_304 0% 70.4% 70.4% V5 0_1ins429 n/a
3 TRCN0000477771 GGACACGGGCGTGCCCGATTCACG pLX_317 26.5% 70.4% 70.4% V5 0_1ins429 n/a
Download CSV