Transcript: Human NM_001287222.1

Homo sapiens actin related protein 2/3 complex subunit 3 (ARPC3), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-07-06
Taxon:
Homo sapiens (human)
Gene:
ARPC3 (10094)
Length:
959
CDS:
152..685

Additional Resources:

NCBI RefSeq record:
NM_001287222.1
NBCI Gene record:
ARPC3 (10094)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001287222.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000036506 TGAAGCTGATAGGACCTTGAT pLKO.1 337 CDS 100% 4.950 6.930 N ARPC3 n/a
2 TRCN0000333049 TGAAGCTGATAGGACCTTGAT pLKO_005 337 CDS 100% 4.950 6.930 N ARPC3 n/a
3 TRCN0000382294 AGAGAGAAGAGCATGTCTTTA pLKO_005 784 3UTR 100% 13.200 9.240 N ARPC3 n/a
4 TRCN0000380498 GTTCATGAACAAGAGTCTTTC pLKO_005 649 CDS 100% 10.800 7.560 N ARPC3 n/a
5 TRCN0000036504 GCCTATCAGAAGTCAATTCAA pLKO.1 217 CDS 100% 5.625 3.938 N ARPC3 n/a
6 TRCN0000333116 GCCTATCAGAAGTCAATTCAA pLKO_005 217 CDS 100% 5.625 3.938 N ARPC3 n/a
7 TRCN0000036507 CCTGCAAACAAACAGGAAGAT pLKO.1 509 CDS 100% 4.950 3.465 N ARPC3 n/a
8 TRCN0000344683 ACCTTGATATATATAACTCTC pLKO_005 350 CDS 100% 4.050 2.835 N ARPC3 n/a
9 TRCN0000036508 CTGATACCAAACTCATCGGAA pLKO.1 183 CDS 100% 2.640 1.848 N ARPC3 n/a
10 TRCN0000333048 CTGATACCAAACTCATCGGAA pLKO_005 183 CDS 100% 2.640 1.848 N ARPC3 n/a
11 TRCN0000036505 CATCTATTACTTCAAGGCCAA pLKO.1 286 CDS 100% 2.160 1.512 N ARPC3 n/a
12 TRCN0000353078 ACAGATATTGTGGATGAAGCC pLKO_005 266 CDS 100% 2.160 1.296 N ARPC3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001287222.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02311 pDONR223 100% 99.4% 99.4% None 378_379insGAA n/a
2 ccsbBroad304_02311 pLX_304 0% 99.4% 99.4% V5 378_379insGAA n/a
3 TRCN0000480688 TCGTCTGCCGGACCTCGGCGTGAA pLX_317 69.6% 99.4% 99.4% V5 378_379insGAA n/a
Download CSV