Transcript: Human NM_001287387.2

Homo sapiens solute carrier family 25 member 1 (SLC25A1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
SLC25A1 (6576)
Length:
1510
CDS:
335..961

Additional Resources:

NCBI RefSeq record:
NM_001287387.2
NBCI Gene record:
SLC25A1 (6576)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001287387.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000369960 AGCCCATGAACCCTCTGATCA pLKO_005 672 CDS 100% 4.950 6.930 N SLC25A1 n/a
2 TRCN0000255350 AGGCGCACAAATACCGGAACA pLKO_005 780 CDS 100% 4.050 5.670 N SLC25A1 n/a
3 TRCN0000377362 TGGCATCGAGATCTGCATCAC pLKO_005 133 5UTR 100% 4.050 3.240 N SLC25A1 n/a
4 TRCN0000042991 ACACTCCTCTGGATGTGATTA pLKO.1 738 CDS 100% 13.200 9.240 N SLC25A1 n/a
5 TRCN0000232826 ACACTCCTCTGGATGTGATTA pLKO_005 738 CDS 100% 13.200 9.240 N SLC25A1 n/a
6 TRCN0000232829 CAGAGTGTCCTGCTACCTTTG pLKO_005 1000 3UTR 100% 6.000 4.200 N SLC25A1 n/a
7 TRCN0000042988 GCCATAGTGTTTGTCATCTAT pLKO.1 896 CDS 100% 5.625 3.938 N SLC25A1 n/a
8 TRCN0000232825 CCATCCGCTTCTTCGTCATGA pLKO_005 612 CDS 100% 4.950 3.465 N SLC25A1 n/a
9 TRCN0000377412 CCCAAGTACAGAGGATTCTTC pLKO_005 500 CDS 100% 4.950 3.465 N SLC25A1 n/a
10 TRCN0000042989 CAGGTTTGGAATGTTCGAGTT pLKO.1 325 5UTR 100% 4.050 2.835 N SLC25A1 n/a
11 TRCN0000042990 GCTGCTCAACAAAGTGTGGAA pLKO.1 931 CDS 100% 2.640 1.848 N SLC25A1 n/a
12 TRCN0000042992 CGGCCTTAGCTCCCTGCTCTA pLKO.1 280 5UTR 100% 0.000 0.000 N SLC25A1 n/a
13 TRCN0000232828 TGGATGTGGCCATAGTGTTTG pLKO_005 888 CDS 100% 10.800 6.480 N SLC25A1 n/a
14 TRCN0000377363 GGGCTCAAGGCATTCTACAAG pLKO_005 836 CDS 100% 4.950 2.970 N SLC25A1 n/a
15 TRCN0000232827 GGCTCAAGGCATTCTACAAAG pLKO_005 837 CDS 100% 10.800 7.560 N SLC25A1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001287387.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06972 pDONR223 100% 66.8% 66.8% None 0_1ins309 n/a
2 ccsbBroad304_06972 pLX_304 0% 66.8% 66.8% V5 0_1ins309 n/a
3 TRCN0000467898 CTTAAGTATCTAGTATCCATGTAA pLX_317 24.7% 66.8% 66.8% V5 0_1ins309 n/a
Download CSV