Transcript: Human NM_001287744.1

Homo sapiens farnesyl-diphosphate farnesyltransferase 1 (FDFT1), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-09-25
Taxon:
Homo sapiens (human)
Gene:
FDFT1 (2222)
Length:
2310
CDS:
533..1594

Additional Resources:

NCBI RefSeq record:
NM_001287744.1
NBCI Gene record:
FDFT1 (2222)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001287744.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000036324 CGCAACGCAGTGTGCATATTT pLKO.1 536 CDS 100% 15.000 21.000 N FDFT1 n/a
2 TRCN0000304225 ACCATTTGAATGTTCGTAATA pLKO_005 1950 3UTR 100% 13.200 9.240 N FDFT1 n/a
3 TRCN0000304162 AGCTGTCAAAGCCATCATATA pLKO_005 1336 CDS 100% 13.200 9.240 N FDFT1 n/a
4 TRCN0000304161 CAACGATCTCCCTTGAGTTTA pLKO_005 717 CDS 100% 13.200 9.240 N FDFT1 n/a
5 TRCN0000099193 GTGTTTAACTTCTGTGCTATT pLKO.1 1193 CDS 100% 10.800 7.560 N Fdft1 n/a
6 TRCN0000317626 GTGTTTAACTTCTGTGCTATT pLKO_005 1193 CDS 100% 10.800 7.560 N Fdft1 n/a
7 TRCN0000036326 ACAAACATCATCCGTGACTAT pLKO.1 980 CDS 100% 4.950 3.465 N FDFT1 n/a
8 TRCN0000036328 ACCTGTCGTTTGTCATGCTTT pLKO.1 1497 CDS 100% 4.950 3.465 N FDFT1 n/a
9 TRCN0000036327 ACTTGCTACAAGTATCTCAAT pLKO.1 464 5UTR 100% 4.950 3.465 N FDFT1 n/a
10 TRCN0000300886 ACTTGCTACAAGTATCTCAAT pLKO_005 464 5UTR 100% 4.950 3.465 N FDFT1 n/a
11 TRCN0000036325 CCTACCTTTCGAGACTCAGAA pLKO.1 1164 CDS 100% 4.950 3.465 N FDFT1 n/a
12 TRCN0000300885 CCTACCTTTCGAGACTCAGAA pLKO_005 1164 CDS 100% 4.950 3.465 N FDFT1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001287744.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06204 pDONR223 100% 84.6% 84.6% None 0_1ins192 n/a
2 ccsbBroad304_06204 pLX_304 0% 84.6% 84.6% V5 0_1ins192 n/a
3 TRCN0000468861 AAGCCTTTATGGTGACAACCTGGA pLX_317 34.7% 84.6% 84.6% V5 0_1ins192 n/a
4 ccsbBroadEn_15415 pDONR223 0% 84.6% 84.6% None 0_1ins192 n/a
5 ccsbBroad304_15415 pLX_304 0% 84.6% 84.6% V5 0_1ins192 n/a
6 TRCN0000480059 TAATTCTCCACATACATTCGTCCA pLX_317 34.3% 84.6% 84.6% V5 0_1ins192 n/a
7 ccsbBroadEn_06205 pDONR223 100% 84.4% 84.6% None 0_1ins192;9C>T;780G>C n/a
8 ccsbBroad304_06205 pLX_304 0% 84.4% 84.6% V5 0_1ins192;9C>T;780G>C n/a
9 TRCN0000473192 CGCGACCCTGCGAGAGAAAGAGTA pLX_317 33.3% 84.4% 84.6% V5 0_1ins192;9C>T;780G>C n/a
Download CSV