Transcript: Human NM_001287753.1

Homo sapiens 3-hydroxymethyl-3-methylglutaryl-CoA lyase like 1 (HMGCLL1), transcript variant 5, mRNA.

Source:
NCBI, updated 2019-07-07
Taxon:
Homo sapiens (human)
Gene:
HMGCLL1 (54511)
Length:
2172
CDS:
160..873

Additional Resources:

NCBI RefSeq record:
NM_001287753.1
NBCI Gene record:
HMGCLL1 (54511)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001287753.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000120095 CCACTGAGGATTTGATATATA pLKO.1 725 CDS 100% 15.000 21.000 N Hmgcll1 n/a
2 TRCN0000062415 CGGCATGGGTTGTTATGAGAT pLKO.1 474 CDS 100% 4.950 6.930 N HMGCLL1 n/a
3 TRCN0000062417 GCAAATATCCTTACGGCCCTT pLKO.1 622 CDS 100% 2.160 1.728 N HMGCLL1 n/a
4 TRCN0000455048 GCTTGACTTGAATGGATTTAT pLKO_005 868 CDS 100% 15.000 10.500 N HMGCLL1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001287753.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03427 pDONR223 100% 69.7% 69.7% None 297_298ins309 n/a
2 ccsbBroad304_03427 pLX_304 0% 69.7% 69.7% V5 297_298ins309 n/a
3 TRCN0000474885 TCCCGTCAATATCTAATATACCAC pLX_317 49.9% 69.7% 69.7% V5 297_298ins309 n/a
Download CSV